using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply

A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year

B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest

C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest

D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores

E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one​

Using The Graph, The Temperature Seasonal Force From The Other Forest Biomes. Choose All The ApplyA)

Answers

Answer 1

Answer:

The correct answer is - A and C,

Explanation:

According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:

The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.

B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.

Answer 2

Answer:

A, C, D

Explanation:


Related Questions

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

Which molecule is produced in the aerobic breakdown of a glucose molecule?

A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH

Answers

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

E. NADPH

thankshope it helpspls mark as brainliest

Answer:

E

Explanation:

it enters the citric acid cycle and generates reducing equivalents in the form of NADPH


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

If an egg cell contains 4 chromosomes, how many chromosomes would a sperm cell of the same
species contain?
a. 4, b.8, c.16

Answers

8 chromosomes. In reality each egg and sperm have 23 chromosomes each in order for produce a healthy zygote

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

Which of the following best describes natural selection?

A. organisms vary in their physical traits, and some are inherited

B. Organisms compete for food and shelter

C. organisms best suited to their environments are most likely to survive and reproduce

D. Organisms produce more offspring than can survive

Answers

Answer: C

Explanation: according to Darwin, out of the vast no of individuals which compete for a place in the world, only those having advantageous variations survive and reproduce
C remember the key word is natural

help................

Answers

The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.

Hope this helps!

HELPPP PLEASEEE
4 ANNOTATE Use the correct terms to complete this diagram showing the reactants and
products for each chemical reaction.

Answers

Answer:

Explanation:

Photosynthesis

Reactants: Carbon dioxide and water

Products: Glucose and oxygen

Respiration

It's the opposite of photosynthesis:

Reactants: glucose and oxygen

Products: Carbon dioxide and water

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

Earth's core is the source of the energy that drives the movement of tectonic plates. Which two processes help transfer this energy outward to earth's crust?

Answers

Answer:The two processes are CONDUCTION and CONVECTION

Explanation:

The Energy produced in the Earth core is generated by  Sun, gravitational force , radioactive decay, and the  Earth' rotation, To maintain balance in the earth, The  processes of CONDUCTION and CONVECTION transfer energy (HEAT) to Earth's interior, which also helps the movement of  tectonic plates at a  constant rate.

Now, inside the earth mantle is made up of hot solid rock and because Conduction occurs more in solids, Its currents helps the continuous  transfer of heat energy  from the warmer mantle at  the bottom   to  the cooler  mantle  at the top While Convection currents in the core move thermal energy causing  the rising and sinking of warm and cooler molten rock inside Earth, thereby maintaining the motion of tectonic plates and  creating a balance in the earth.

Answer:

Conduction and Convection

Explanation:

What does a bioprospector do?

Answers

Answer:

bioprospecting. The analysis of plants, animals, insects and other organisms in an ecosystem with high biodiversity for therapeutic candidate molecules and substances.

Explanation:

Answer:

It does the analysis of plants, animals, insects and other organisms in an ecosystem with high biodiversity for therapeutic candidate molecules and substances.

Explanation:

Humans, and other animals, exhale
A. oxygen

B. natural gas

C. carbon dioxide

D. cytoplasm

Answers

Answer:

C

Explanation:

Humans,and other animals,exhale carbon dioxide and inhale oxygen.

Answer:

c: humand and animals exhale carbon dioxide

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

I need help on this one!​

Answers

Answer:

Classify I beilieve!

Explanation: You would need to do this because in order for you to study it you would have to classify them.

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

7. How does a beach mouse get its trait? The order of the process is:
A.RNA → Gene A → Protein A → Amino Acid → Fur color
B.Gene A → Amino Acid → Protein A → RNA → Fur color
C.Protein A → Amino Acid → RNA → Gene A →Fur color
D.Gene A → RNA → Amino Acid → Protein A → Fur color
E.RNA → Gene A → Amino Acid → Protein A → Fur color

Answers

D. Gene A - RNA-Amino Acid- Protein A- Fur Color. i believe this is correct

2. A mouse running away from the sound of an owl's wings is
an example of the mouse's ability to
A. reproduce
B. grow and develop
C. respond to the environment
D. obtain energy
Check Answer

Answers

Answer:

C Respond to the environment

A mouse running away from the sound of an owl's wings is responding to the environment.

What are living organisms?

The organism which can breathe, reproduce and have the ability to respond to an environment are some of the characteristics of a living organism.

Reproduction is the ability of an organism which gives similar kinds of organisms. Organisms grow and develop through cell division. Cell division is of two types mitosis and meiosis. Mitosis is an equational division.

The organism can respond to the environment. Mouse running away from the sound of an owl's wing is an ability to respond environment. Different organisms can obtain energy from food sources.

Therefore,  A mouse running away from the sound of an owl's wings is responding to the environment.

To learn more about sensitivity refer to the link:

https://brainly.com/question/14057226

#SPJ2

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

List 4 chordate characteristics.

Answers

Answer:

notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail

Explanation:

had to censor second to last word but the 4 is an a

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

Which two molecules are produced over the course of the light and dark reactions of photosynthesis?

glucose

water

carbon dioxide

pyruvic acid

oxygen

Answers

the light independent reactions send NADP+ and ADP back to the light dependent reaction to convert them into ATP and NADPH. The light-independent reactions send the ATP and NADPH made during the light dependent reactions to the dark reaction to make glucose.

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

Help please :) thank u

Answers

Answer:

!! neither mechanical nor chemical digestion

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka  #DRIPPQUEENMO

Hope this helped!!!

Viruses can be prevented by receiving a weakened form of the virus called a?

A)plastid
B)vaccine
C)antibiotic
D)fertilizer

Answers

vaccine, the answer is B

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Other Questions
What is the measure of angle CBD? What is the length of segment CD? cm Which trigonometric ratio can be used to compare BC to CD using angle CBD? What is the approximate length of BC? cm What is the approximate length of BD? cm What is the value of z in the equation 3z + 5 = 4z - 2? I NEED THE WORK Read and contrast two passages about sun safety.Which difference can be found when contrasting thesetwo passages?Passage 1"It is a scientific fact that everyone needs sunscreen,regardless of skin color or ethnic origin. All people aresubject to sun damage."O The first author uses humor to appeal to children.O The second author uses humor to appeal tochildren.Passage 2"No one wants to look like a lizard! You need a bigsquirt of sunscreen before heading outside to play.Sunburns are no fun, so protect yourself."The first author uses scientific facts to appeal tochildren.O The second author uses scientific facts to appeal tochildren. Complete the following sentence.The zone of proximal development is a concept that was introduced by____ Conservatives are often considered to be the left of the political spectrum, while liberals are considered to be right of the political center.Please select the best answer from the choices providedTF PLZ HELP ASAP John Bunyan was imprisoned because he was an Anglican minister.TrueFalse Which of the following is NOT true of women serving in war? Which of the following scenarios will decrease the genetic variation of a population? Find the value of x in the triangle shown below.113212Choose 1 answers explain the term diversity Select the statement that describes the expression (one fourth x 8 + 3) 5. Add three to the quotient of one fourth and 8, then divide by 5 one fourth times the product of 8 and 3, then divide by 5 Add 3 to the product of one fourth and 8, then divide by 5 Add 3 to the sum of one fourth and 8, then divide by 5 If the vehiche has a speed of 24.0 m/s at point a what is the force of the track on the vehicle at this point? The main cause of the cold war 4. PART B: Which detail from the text best supports the answer toPart A?O A That word 'guys' might earn smiles and nods ofunderstanding in that world, but it brought the ultimateinsult in my neighborhood." ( Paragraph 5)OB "With one boy in particular, my mother had to sit me downand explain: 'Son, perhaps there's another reason why hisparents keep making excuses for why we can't get together."(Paragraph 18)O c "Painful as some of these experiences were, I was grateful tohave them in middle school and high school, so that when thetime came to head for college, I already had some fluencynavigating between different cultures" ( Paragkaph 12)OD "I watched as too many others from my hometown and otherpredominantly black cities struggled in a university settingwhere suddenly they really were a minority." (Paragraph 20 An unknown amount of Al203 decomposed producing 215 g of solid aluminum. 2Al2O3=4Al+3O2 How many grams of oxygen gas should be produced g(1) = 4g(n) = g(n-1).(-3)g(3)= are the most common forms of sexual harassment? I need help please ????!!! If angle A measures 40 what is the measure of angle B? What do radio waves and microwaves have in common?Both are at the side of the spectrum that has the highest frequency.Both have shorter wavelengths than visible light.Both have lower frequencies than visible light.Both have radiant energy than visible light.