Answer:
A
Explanation:
because is a good solution for injuries
Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3
Answer and Explanation:
La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.
Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.
El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.
ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3
Codones ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT
ARNm ⇒ UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA
Codones UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.
Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.
AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU
La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.
UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
TYR SER TRP VAL Stop THR ARG ILE ARG PHE PHE Stop
what is a good definition of photosynthesis?
A. using glucose to create light
B. putting together lights so we can see
C. using light to put together food (glucose)
Answer:
The best answer is C
Explanation:
Plants use light to create their own food. this is called photosynthesis
Answer:
C
Explanation:
The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.
When looking at the cell membrane, where are the lipid heads located?
Answer:
The cell membrane consists of two adjacent layers of phospholipids, which form a bilayer. The fatty acid tails of phospholipids face inside, away from water, whereas the phosphate heads face the outward aqueous side.
The cell membrane consists of two adjacent layers of phospholipids, which form a bilayer. The fatty acid tails of phospholipids face inside, away from water, whereas the phosphate heads face the outward aqueous side.
What is cell membrane?
The cell membrane is a biological membrane that separates and protects the interior of all cells from the outside environment.
Moreover, the cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.
Hence, cellular membranes — including plasma membranes and internal membranes — are made of glycerophospholipids, molecules composed of glycerol, a phosphate group, and two fatty acid chains.
Learn more about cell membrane:
https://brainly.com/question/13524386
#SPJ2
please help me answer this
Answer:
last one a dormancy structure D
Explanation:
It helps keeps bacteria and stuff dormant`
How do I calculate Ph?
Explanation:
To calculate the pH of an aqueous solution you need to know the concentration of the hydronium ion in moles per liter (molarity). The pH is then calculated using the expression: pH = - log [H3O+].
which sequence demonstrates the increasing complexity of levels of organization in multuticelluar organisms ?
A organelle_cell_tissue_organ_organ system_oraganism
B cell_organelle_tissue_organ_organsystem organisms
C organelle_tissue_cell_organ_organ system organisms
D cell_organism _organ_organ system _tissue_organelle
Answer:
it's A
Explanation:
It's just a simple chain. Many Organelles form cell, many cells form a tissue, many tissues together form an organ, various organs together form an organ system and different organ systems together make a complete organism.
I hope it helps :))
Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.
Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.
Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase
Explanation: I got it right hopefully it helps
Answer:just did it
Explanation:
Which of the following organelles is properly matched to it's function?
lysosome: storage
endoplasmic reticulum: movement
lysosome: digestion
chloroplast: making proteins
The organelle properly matched to it's function is
-(C) lysosome: digestion
Explanation:
Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies
Endoplasmic reticulum : to produce proteins for the rest of the cell to function.
Chloroplast : They are responsible to carry out photosynthesis
what do you mean by faunal Diversity
Answer:
animal life especially
Explanation:
i hope it helps
this is my answer
correct me if im wrong
#carryonlearning
which process reduces the number of chromosomes by half
Answer:
Meiosis process reduces the number of chromosomes by half.
Explanation:
Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.
Answer:
meiosis
Explanation:
meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells
according to this time table a train --------- at 3 o'clock .A will leave .B is leaving C. is going to
Answer:
is going on is your answer
Classify each of the samples in the grid below as one of the following substances. Each one may be used more than once:
si 0?no Nop suficientemente silvestre usuario independencia 6t?
2. Ang
ay isang genre na gumagamit ng mahika at
iba pang supernatural na penomena bilang punong elemento
ng plota, tema, at/o ganapan.
A. Pabula B. Drama
C. Pantasya D. Mga Tula
Answer:
C. Pantasya
Explanation:
Ang anumang genre ng pantasya ay magkakaroon ng isang uri ng supernatural o magic na tema na isinama dito
Sana nakatulong ito :)
A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia
Answer:
The correct option is 2 Nephrogenic diabetes insipidus.
Explanation:
Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.
As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.
Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.
Therefore, the correct option is 2 Nephrogenic diabetes insipidus.
That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.
what are alleles mutations in the dna
Answer:
Mutations Are Recessive or Dominant
Gizmos ( Building DNA )
Activity A :
Question : What is the structure of DNA
Build : follow the steps given in the gizmo to construct a molecule of dna
Answer:
Double Helical Spiral structure
Explanation:
DNA is a helical spiral structure in which two long strands of nucleotide form a double helix structure.
It looks like a structure of ladder in which the phosphate and sugar molecules from the side of the ladder and the base pairs form the rungs.
How are the early stages of embryonic development different from the later stages of development?
IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE
What is the smallest LIVING part of an organism?
A. Molecules
B. Cells
Answer:
Hi, there the answer is a cell
Explanation:
The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.
Answer:
B. Cells
Explanation:
The cells are the smallest living part of an organism.
Someone pls help me ill give out brainliest pls don’t answer if you don’t know
Ivy grows specifically on stone walls, what type of response is this?
A. Hydrotropism
B. Thigmotropism
C. Phototropism
D. Geotropism
Answer:
B. Thigmotropism
Explanation:
Thigmotropism is a directional growth movement which occurs as a mechanosensory response to a touch stimulus. Thigmotropism is typically found in twining plants and tendrils, however plant biologists have also found thigmotropic responses in flowering plants and fungi.
Answer:
B. Thigmotropism
Explanation:
The ivy grows specifically on stone walls, it shows Thigmotropism.
Bacteria and fungi fulfill which role in an ecosystem?
A. Consumer
B. Decomposer
D. Producer
Answer:
B. Decomposer
Explanation:
Bacteria and fungi fulfill the role of decomposers in an ecosystem. Hence, option (B) is the correct answer.
How to overcome Confusion?????
Answer:
use a full heal
Explanation:
Female mosquitoes need a meal of blood from a person or other animal in order to produce eggs. It has been discovered that mosquitoes have cells on their antennae that can detect the insect repellent known as DEET. The repellent is not harmful to mosquitoes, but when mosquitoes detect DEET, they will not land on the surface where the DEET has been applied. This protects people from being bitten by mosquitoes. Recently, scientists found some mosquitoes that are resistant to DEET because they do not detect its presence. They bred these mosquitoes and eventually produced a population consisting of about 50% DEET- resistant insects. Identify the process most likely responsible for a mosquito initially becoming resistant to DEET.
Answer:
Mutation followed by natural selection made mosquitos resistant to DEET
Explanation:
Natural selection selects beneficial alleles, which increase their frequency in the population, resulting in adaptation. Aptitude, which is the contribution of each genotype to the next generation, increases too.
In many cases adaptations, resulting from the natural selection process can be correlated to environmental factors or selective pressures applied by other organisms or habitats.
Let us remember that, a mutation is a change or alteration in DNI sequences that introduce new variants. Many of these are eliminated, but some of them might succeed and be incorporated into each individual. These mutations are the ones that have been selected by natural selection.
So, in the exposed mosquitos´ example,
The selective pressure or modeling environmental factor is the DEET repellent.Some of the mosquitos mutated changing their behavior. The new mosquito´s response is not-detection of the repellent presence -only in those individuals carrying the mutations-. Natural selection benefits these mutations. Mosquitos survive and become more resistantProbably some of the mosquitos in the population suffered a mutation that favored them in not detecting repellent DEET. These individuals developed resistance to the chemical and were able to survive and reproduce, enhancing population sizes again. Natural selection benefited the mutation that gave them resistance.
Let us remember that the term resistance refers to an inheritable change in the population sensitivity, reflected through the consecutive failure of the chemical effects, correctly used in order to cause an effect on the insect population.
Repellents might produce a genetic modification in the insects, leading them to not detect the chemical. Insects evolve with the capability of tolerating the DEET dose that normally is used to repel mosquitos
The excessive use of DEET leads to the fixation of new genes -by natural selection- that result from mutations in the mosquito genetic material, which makes them become even more resistant to the chemical.
what are the three main particles of soil are? How do these shape and influence the type of soil we observe and its uses?
Answer:
Soil particles vary greatly in size, and soil scientists classify soil particles into sand, silt, and clay. Texture indicates the relative content of particles of various sizes, such as sand, silt and clay in the soil. Texture influences the ease with which soil can be worked, the amount of water and air it holds, and the rate at which water can enter and move through soil. Soil provides plants with foothold for their roots and holds the necessary nutrients for plants to grow; it filters the rainwater and regulates the discharge of excess rainwater, preventing flooding; it is capable of storing large amounts of organic carbon; it buffers against pollutants, thus protecting groundwater.
Photosynthesis in plants is an example of
Answer: If you are asking if your answer is correct, it is. Photosynthesis is the process of converting sunlight into food and energy, therefore it is an example of nutrition.
Photosynthesis in plants is an example of nutrition
What is photosynthesis?
Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.
It is carried out by algae, plants and even some microorganisms.
The sugar produced form photosynthesis is a great source of nutrients for photosynthetic organisms and plants.
Therefore, photosynthesis in plants is an example of nutrition
Learn more about photosynthesis here:
https://brainly.com/question/3529377
#SPJ9
The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole
What might analysts be able to use tunable lights for?
This is for a forensics class.
Explanation:
crime scene investigators and forensic examiners are now using "alternate light sources" to identify residues and prints which cannot be seen under normal light conditions.........could there be a role for them to this end?
EARTH SCIENCE CLASS
Why is the street (asphalt) hotter than the sidewalk in the summer ?
Answer:
bad albedo ? sorry if not right
Cellular respiration is how living things obtain energy for life. The organelle where cellular respiration takes place is the
A. chloroplast
B. Golgi body
C. mitochondria
Answer:
C. Mitochondria
Explanation:
