What do the three unities NOT include?
Select one:
a. action
b. place
c. character
D. Time​

Answers

Answer 1

Answer:

character is not one of the three unities.

Explanation:

Answer 2
The answer to ur question is B

Related Questions

What is the function of an interjection?

A. To tell a location or time
B. To join two ideas in a sentence
C. To describe a verb or a noun
D. To show emotion or feeling

Answers

B. To join two ideas in a sentence.

The function of an interjection is to show emotion or feeling. They don't follow the remainder of the statement correctly. D is the right option.

The ads within the code you gave are utilized to communicate the taking after feelings:

Wow! - Shocking

Goodness no! - Stun

Goodness, expensive! - Astonish

Here are some more pointers for efficiently using interjections:

Use them in moderation. It's crucial to utilize interjections cautiously since they might be misused. They will lose their impact if you use them excessively.

Use them to convey powerful feelings. Strong emotions are best expressed through interjections. You don't need to use an interjection if you're only a little bit joyful. However, if you're thrilled, adding an exclamation like "Hurray!" may dramatically improve your work.

Hence, the correct option is D. To show emotion or feeling

Learn more about interjection, here:

https://brainly.com/question/1633224

#SPJ6

I’m going To need your help on This no links on My question or I will report you

Answers

Answer:

1.D

2.C

3.C

4.B

Explanation:

1. Implode means to get smaller

2. Supernova is a stellar explosion

3. massive is large

4. light year is a time period

1) D. Becomes a tiny dot

2) C. The explosion of a start

3) C. Very large

4) B. How far light travels in one year


Hope this helps, I did my best.

HURRY PLEASE HELP What is the theme of the passage?

A.
Taking advice from others may prove to be beneficial.
B.
Overloading oneself can lead to unforeseen consequences.
C.
Relaxation and meditation are important activities.
D.
One must take care when doing activities after school.

Answers

Answer:

B because C has nothing to do with the story and A is not a very logical answer D is a very close answer but if he would listen to his friend he wouldn’t have overworked himself

Explanation:

Overloading oneself can lead to unforeseen consequences can be considered the theme of the passage. Thus, option B is correct.

What is the theme?

A theme is a message that the author or the writer of the passage or excerpt wants the people to show. A theme is important as it involves the concept of writing.

In this passage, it shows that Anson and Enrique are both signing up for the Activities fair where Enrique only selects one or two activities, and Anson decides to sign up for all these activities.

After signing for them, he gets so busy that he can not do anything or concentrate on a single activity he lost sleep, math test, soccer, and guitar practice everything was compromised.

So overloading himself with all the activities, he had to face the consequence in school and playground. Therefore, option B is the correct option.

Learn more about the theme, here:

https://brainly.com/question/12461958

#SPJ5

PLZ HELP ASAP John Bunyan was imprisoned because he was an Anglican minister.

True
False

Answers

Answer:

true

Explanation:

In the 1600s , the Angelic church was seemed as a treachery because some of it's structure does not fit the Traditional Catholic ( which was was imposed on all England). John Bunyan is one of the most famous Anglican Minister in the Era. A lot of European Angelic Churches honor his death on every August 31st 

Answer:

True

Explanation:

Which of the following expresses a fact?

Question 2 options:

a)

Eating fast food isn't bad if you only eat it once per week.


b)

Burning the American flag should be a crime.


c)

On average, college graduates earn more money in their lifetimes than high school graduates.


d)

Sometimes curly hair can look better than straight hair.

Answers

Answer:

C

Explanation:

C is a fact and it isnt an opinion

What types of nouns should be used in effective process writing?
Discuss the last time you explained a process to someone at home, at school, or at work
Was your explanation effective?


WILL GIVE BRAINLIST






X







X





X





X
X

X

X
X
X


X

X

X
X
X
X
X

X
X
X

X
X


















X

Answers

Answer:

person place or thing or idea

4. PART B: Which detail from the text best supports the answer to
Part A?
O A “That word – 'guys'– might earn smiles and nods of
understanding in that world, but it brought the ultimate
insult in my neighborhood." ( Paragraph 5)
OB "With one boy in particular, my mother had to sit me down
and explain: 'Son, perhaps there's another reason why his
parents keep making excuses for why we can't get together."
(Paragraph 18)
O c "Painful as some of these experiences were, I was grateful to
have them in middle school and high school, so that when the
time came to head for college, I already had some fluency
navigating between different cultures" ( Paragkaph 12)
OD "I watched as too many others from my hometown and other
predominantly black cities struggled in a university setting
where suddenly they really were a minority." (Paragraph 20

Answers

Answer:

“With one boy in particular my mother had to sit me down and explain.”

Explanation:

Perhaps this one “boy” doesn’t want to be a boy anymore and gets offended when the main character refers to them as a “guy” or was never a guy to begin with. In that case it would make sense that the boy would get offended

Select the correct text in the passage.
Which statement best shows Brutus's attempt to appeal to his audience?
Julius Caesar
by William Shakespeare

Answers

Answer:

:)

Explanation:

What is correct to say....as a ladies in charge or....as a lady in charge?

Answers

Answer: "as a lady in charge"

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

" as a lady in charge " would be correct

thanks

hope it helps

Write a short note on the topic ,' My Mother '.​

Answers

Answer:

My mother is the best mom, she does everything for me and I'm eternally grateful for her.

Explanation:

He was very nice and talked slow like Miss Kinnian does and he explaned it to me that it was a raw shok. He said pepul see things in the ink. I said show me where. He said think. I told him I think a inkblot but that wasnt rite eather. He said what does it remind you - pretend something. I closd my eyes for a long time to pretend. I told him I pretned a fowtan pen with ink leeking all over a table cloth. Then he got up and went out. —“Flowers for Algernon, Daniel Keyes

what characterizes Charlie in this passage

description of Charlie
what other people say about Charlie
how Charlie thinks ​

Answers

Answer:

C   ;how Charlie thinks ​

Explanation:

Answer:

The person overtop is right

Explanation:

Just to Clarify.

Question 6
READ ITI
What happens because Kylo tries to get attention instead of being a
team player?
Nico scores the winning goal,
He is not voted Most Valuable Player
Jamol becomes the team's highest scorer
His team loses to the Cougars

Answers

Explanation:

he was not voted most valuable player

Why is the waste going to those countries instead of saying in the United States for recycling? In complete sentences

Answers

The correct answer to this open question is the following.

Unfortunately, you forgot to include the name of "those countries" that receive the waste from the United States. Without the names, we are limited to fully answer.

However, trying to help you we can comment on general terms based on our knowledge of this topic.

Many times the waste going to underdeveloped o poor countries instead of saying in the United States for recycling is because it is cheaper for the United States to send that waste abroad to those countries. Another reason is that environmental laws in the US are stricter than in other countries, so US industries have to invest more money to comply with United States environment regulations. So these industries prefer to pay to other recycling companies abroad.  

In those other countries, legislation is not as strict as in the US or sometimes environmental legislation is non-existent. The problem is that in these countries people, civilians, suffer the consequences.

Battle in your own words sentences

Answers

Answer: We lost many men in the long-lasting battle but in the end, we won. Our bruises and blood were washed away from the glory of winning. The death of our brothers was not in vain.

a is a mountain or hill a vent through which lava erupted from the Earth's?​

Answers

Answer:

A mountain is more likely to have a vent through which lava erupts from the Earth.

Explanation:

By the way, can you follow me on Brainly?

Thanks!

True or false: The following sentence is correct?
“In thirty years,” Rodriguez claims, “we will all be in driverless cars.”
Select one:

True


False

Answers

Answer:

true

Explanation:

We can't know what will the next innovation of humanity. We managed to fly to other space, who knows if someone can create a driverless car.

The girls, how does this poem describes gender norms for women’s

Answers

Answer:

That women are objects to men and can just be thrown away when they are bored

Explanation:

Convert 77° F into kelvins.
Conversion Formulas
C° = (F° - 329) - 1.8
Fo= 1.8 x C° + 320
K= C° + 273

Answers

77° F converts into 298.15 in kelvins

please help please
Which of the following is NOT a basic belief or practice in Chinese Folk Religions?
Yin and Yang
Fasting
Filial Piety
Ancestor Worship

Answers

Answer:

ancestor worship is your answer to your question you have given

ancestor worship is the answer

The rude behavior of the customer service representative was the cause of my decision to quit doing business with the company.

What is the best way to edit this sentence to make it more concise and effective?


The customer service representative’s rude behavior caused me to quit doing business with the company.


The extremely rude behavior of the customer service representative was the cause of my decision to quit doing business with the company.


The rude behavior of the customer service representative was the cause of my decision to take my business elsewhere and quit doing business with the company.


Her rude behavior was the cause of my decision to quit doing business with them.

Answers

Answer:

the customer service representative’s rude behavior caused me to quit doing business with the company.

Explanation:

I believe this is correct, it really just depends on what you are learning bout! If i am wrong so sorry!!!

It might be ¨The extremely rude behavior of the customer service representative was the cause of my decision to quit doing business with the company.¨ because I was trying to pick the one that was closet to the first one, now the reason this isn't my first pick is because in the OG one it does not say ´extremely´ but just let me know if it is wrong!

The most effective and concise way to edit the given sentence is given in option (a): "The customer service representative’s rude behavior caused me to quit doing business with the company."

How can the issue be put up concisely?

The given options talk about the rude behavior of the customer service representative, the usage extremely is not a concise form of expressing the situation, it actually gives leads to exaggeration.

The cause and reason effect of describing a situation turns out to be complaining in nature rather than stating the actual incidence.

The blaming of one's action to shut one's own business describes the lack of confidence in oneself and not the actual incidence.

Therefore, The exact happening of how you have been treated and what it leads you to do in the future is the right way of expressing the issue in a direct way. Hence, option (A) or (I) or (i) is the correct answer.

Check out the link below to learn more about rude behavior;

https://brainly.com/question/8414117

#SPJ2

Other Questions
Which limiting factor is this adaptation a response to An ideal horizontal spring-mass system is set into motion. At an instant when the mass passes through its equilibrium position: The potential energy in the spring is at its _____. The kinetic energy of the mass is at its ______. The magnitude of net force acting on the mass is at its ______. I need help with this question How many minutes are there in 12.5 hours? 2. Which ethic do you think is most important for a journalist to have? Why? Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Why would an investor want to choose a certificate of deposit over a corporate bond Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives