what is 5.75 divided by -0.15?

Answers

Answer 1

Answer:

-38.33333333333333333333333334

Answer 2
-38.3 is the answer

Related Questions

plz answer below will make u brainliest help plz

Answers

Answer:

first one 5 - 30

second one 21 : 7

third one 16 : 32

Step-by-step explanation:

Answer:

Question 1: Gemma gets 5 biscuits and Zak gets 30 biscuits.

Question 2: Emily gets 21 marbles and Asif gets 7 marbles.

Question 3: Niamh gets 16 pencils and Jack gets 32 pencils.

Step-by-step explanation:

Just keep the ratios consistent

A tea set was bought for $ 328, if a discount of 12% is offered on the price. Find the price of the tea set.

Answers

288.64

this is the real answer the last one was a mistake

What is the factored form of 8x^24-27

Answers

Answer: 4.722

Step-by-step explanation:

Answer:

C

Step-by-step explanation:

Which of the following is equivalent to the expression below?
(7 X + 8) + (15 - 7x)
OA. 7x+ 23
B. 14x + 23
23
D. 7​

Answers

Step-by-step explanation:

7x + 8 + 15 - 7x

Solving like terms

23

Option C is the correct answer

Answer:

23

Step-by-step explanation:

Given

(7x + 8) + (15 - 7x) ← remove parenthesis

= 7x + 8 + 15 - 7x ← collect like terms

= 23

Find the unit rate. Round to the nearest hundredth, if necessary.

$220 for 17 ft2

Answers

Answer:

12.94 for 1 ft squared

Step-by-step explanation:

You divide 220 by 17.

Answer:

$12.94

Step-by-step explanation:

For 17 ft² = $220

Unit rate = 220/17 = $12.94

-5*(-6)=
-27 divided by 9=

Answers

Answer:

-5*(-6) = 30

-27/9 = -3

Step-by-step explanation:

We know a negative times a negative is a positive, a positive times a positive is a positive, and a negative times a negative is a positive. This rule goes the same for division.

Using that rule -5*(-6) = 30. Which is a negative times a negative = positive.

-27/9 = -3 Which is a negative divided by positive = negative

-5*(-6)=30
27 divided by 9= -3

To find the mileage, or how many miles a car can travel per gallon of gasoline, you can use the expression m/g, where m is the distance in miles and g is the number of gallons of gas used. Find the mileage in miles per gallon for a car that travels 585 miles on 18 gallons of gas? (Your answer does not need miles per gallon at the end.)

Answers

Answer:32.5

Step-by-step explanation:

585/18

which of the following equations does not have a solution of x = 6?​

Answers

Answer:

blue box x-22=28

Step-by-step explanation:

message me

Answer:the blue square since it would become -28

Step-by-step explanation:

To convert degrees Fahrenheit (F) into degrees Celsius (C) use the formula C=5/9(F-32) convert 50 degrees Celsius to Fahrenheit

Answers

Answer:

Step-by-step explanation:

C=5/9(F-32)

Or F-32=9/5C

Put  C=50

F-32=9/5 ×50

F-32=90

F=90+32=122°F

What is the range for this data set?
37 years
9 years
41 years​

Answers

Answer:

30 years

Step-by-step explanation:

41 minus 11=

What is the probability that a randomly selected player is a boy on the Sunderland team?

Hint: Sunderland boy/grand total.


.384


.462


.615


.538

Answers

Answer:

7/30

Step-by-step explanation:

First we need to find the number of girls on the Newcastle team, which is the total number of girls minus the number of girls on the other team, giving us 20-6=14. This means the number of player total is 3+7+6+14 or 30 players. There are 7 Sunderland boys so we have 7/30

The answer is 462 :)

Will give brainliest, What types of solutions will a quadratic equation have when the discriminant b^2−4ac in the quadratic formula is zero?
Two non real solutions
One real solution
Two real solutions
No solutions

Answers

Answer:

B

Step-by-step explanation:

When a discriminant is zero, the quadratic equation has one solution.

-9x+2y=16
7x+2y=16
A8,1
B8,0
C8,-10
D0,8

Answers

D 0,8
if you replace the letters with the numbers , you’ll get it right.

help help please!!!!!!!!!!!!!!!!

Answers

Answer:

1000 times

Step-by-step explanation:

900000 divide 900 equals 1000

Answer:

it would be 1000 times.

Step-by-step explanation:

All you have to do is find out how many zeros you can put before the 900 and then put a one after it. And don't mind all of the other numbers. They don't matter in this equation. Pretend they are all zeros.

900,000

000,900

You see how many zeros there are before the 900.

Then just add a one 1000

Jodi learned to sing a total of 4 pieces over the course of 2 weeks of voice lessons.
After 8 weeks of voice lessons, how many pieces will Jodi be able to sing in total?
Assume the relationship is directly proportional.

A: 16 pieces
B: 20 pieces
C: 15 pieces
D: 12 pieces

Answers

Answer:

A. 16 pieces

Step-by-step explanation:

If Jodi learned to sing a total of 4 pieces over the course of 2 weeks of voice lessons, after 8 weeks of voice lessons, Jodi be able to sing 16 pieces.

2 x 2 =4

8 x 2= 16

Therefore the answer is 16.

Hope this helps and I explained it well enough !

Have a nice day.

Triangle A’B’C’ is the image of triangle ABC.

On a coordinate plane, triangle A B C has points negative 4, negative 1), (negative 5, negative 5), (negative 3, negative 4). Triangle A prime B prime C prime has points (3, 4), (4, 8), (2, 7).

Which transformations could have been used to create A’B’C’ ? Choose all that apply.
a 180Degrees rotation about the origin and then a translation 3 units up and 1 unit left
a translation 3 units up and 1 unit left and then a 180Degrees rotation about the origin
a 90Degrees clockwise rotation about the origin and then a reflection over the y-axis
a 90Degrees counterclockwise rotation about the origin and then a reflection over the x-axis
a translation 3 units down and 1 unit right and then a 180Degrees rotation about the origin

Answers

The Answer is A and D

Hope this helps

Answer:

Its the First and Last answer on Edg

Step-by-step explanation:

I took the test

What’s the answer to this??

Answers

Answer:

i think the letter d is the correct answer sorry if im wrong

Answer:85

Step-by-step explanation:

360-119-71=170

170÷2=85

harold collected data on the daily high temperature in two cites over a period of one week . he analyzed the data and found the measures below . which statement is true based on these measures

Answers

Answer:

The temperature in Carlton was always cooler than in Borden.

Step-by-step explanation:

Answer:

d

Step-by-step explanation:

A garden measuring 12 meters by 6 meters is going to have a walkway constructed all around the perimeter, increasing the total area to 160 square meters. What will be the width of the pathway? (The pathway will be the same width around the entire garden).
Pls Show Work

Answers

Answer:

Width of Pathway; 2 meters

Step-by-step explanation:

To determine the width of the pathway we can tell that the length of the ends ( in meters ) is distributed among the two other ends of the garden so that the width ⇒

Increase length on one side * 2, if increased length / width ⇒ x, 2x

From this we can formulate an equation based on the lengths of the garden, as the increased lengths represents the side lengths of the total area ( walkway + garden );

( 12 + 2x )( 6 + 2x ) = 160 ⇒ Expand,

72 + 36x + 4x^2 = 160 ⇒ Subtract 160 on either side,

4x^2 + 36x - 88 = 0 ⇒ Factor,

4 * ( x - 2 ) * ( x + 11 ) = 0 ⇒ Use Zero Factor Principle,

x = 2, and x = - 11;

Now the width can only be a positive value, thus;

Solution; Width ⇒ 2 meters

what is the triangular number of (546)

Answers

Answer:

Step-by-step

149331:

Answer:

149331

Step-by-step explanation:

hope its correct and it helps

please answer this and please provide explanation since I need to explain in homework thank you I really appreciate it

Answers

Answer:

27648inches÷64inches=432 tiles

Step-by-step explanation:tiles cost 3456

I WILL GIVE YOU BRAINLIEST!!!!! The first side of a triangle is three times as long as the second side, and the third side is 50 cm shorter than the first side. Find all sides of the triangle if its perimeter is 370 cm. PLS HELP ME!!!!!!!

Answers

Answer:

The first side of the triangle = 180 cm

The second side of the triangle = 60 cm

The third side of the triangle =130 cm

Step-by-step explanation:

To solve this, we will follow the steps below;

First, re-write the question in a mathematical format and then solve;

let a=the first side of the triangle

b=the second side of the triangle     and

c=the third side of the triangle

"The first side of a triangle is three times as long as the second side" can be re-write mathematically as:

a=3b ------------------------------------------------(1)

"the third side is 50 cm shorter than the first side" can be re-write as :

c=a-50-----------------------------------------------(2)

"perimeter is 370"  can be re-write as:

a + b + c = 370 --------------------------------------(3)

from equation (2), make b subject of the formula; a= 3b

b=a/3  ------------------------------------(4)

substitute equation (2)   and (4) into equation (3)

a + b + c = 370

a+[tex]\frac{a}{3}[/tex] + a-50 = 370

add 50 to both-side of the equation

a+[tex]\frac{a}{3}[/tex] + a-50 + 50= 370 + 50

a+[tex]\frac{a}{3}[/tex] + a= 420

[tex]\frac{3a + a + 3a}{3}[/tex]  = 420

[tex]\frac{7a }{3}[/tex] = 420

multiply both-side of the equation by 3

[tex]\frac{7a }{3}[/tex] ×3= 420×3

7a = 1260

Divide both-side of the equation by 7

[tex]\frac{7a}{7}[/tex]  =  [tex]\frac{1260}{7}[/tex]

a= 180

from equation (4)   b = a/3

b = 180/3 = 60

from equation (2)  c= a- 50

c= 180 - 50

c= 130

a=   180 cm    

b = 60 cm

c= 130 cm

Therefore,the first side of the triangle = 180 cm

the second side of the triangle = 60 cm

the third side of the triangle =130 cm

A runner won a 100-meter race with a time of 9.73 seconds.

How can you use place value to explain this time?

Answers

Answer:

You can move the place value over to explain

Step-by-step explanation:

Answer:

The runner is going exactly 10.2774922919 meters per second

Step-by-step explanation:

Using the ratio 100:9.73, we can simplify that to 10.2774922919:1

−7(5x−8)
Expand the following Expression

Answers

Steps for solving:

Start by changing the -8 to plus a negative 8.

Now, the -7 distributes through the parentheses.

This gives us -7(5x) + -7(-8) which simplifies to -35x + 56.

Find the 40th term of this arithmetic sequence 4,9,14,19

Answers

Answer:

199

Step-by-step explanation:

I believe it's 199. The interval is just 5.

Answer:

the answer is going to be more than 11111111111119 (this is the 26th term)

Step-by-step explanation:

prove that (tan²y) (cos²y) + 1/sec²y = 1​

Answers

Answer:

see explanation

Step-by-step explanation:

Using the trigonometric identities

tan x = [tex]\frac{sinx}{cosx}[/tex] , sec x = [tex]\frac{1}{cosx}[/tex] , sin²x + cos²x = 1

Consider the left side

tan²y × cos²y + [tex]\frac{1}{sec^2y}[/tex]

= [tex]\frac{sin^2y}{cos^2y}[/tex] × cos²y + [tex]\frac{1}{\frac{1}{cos^2y} }[/tex] ← cancel cos²y in the product

= sin²y + cos²y

= 1

= right side ⇒ proven

Step-by-step explanation:

[tex] (\tan^2y) (\cos^2y) +\frac{1}{\sec^2y} = 1\\

LHS

= (\tan^2y) (\cos^2y) +\frac{1}{\sec^2y} \\\\

\frac{\sin^2y}{\cos^2y}\times \cos^2 y + \cos^2 y \\\\

= \sin^2y + \cos^2 y \\\\

= 1\\\\

= RHS\\\\

\purple {\boxed {\bold {\therefore (\tan^2y) (\cos^2y) +\frac{1}{\sec^2y} = 1}}} \\[/tex]

Hence Proved

How would you slice a right rectangular prism to create a pentagon?

A.
Slice the prism such that the plane cuts through all of the six faces.

B.
Slice the prism such that the plane cuts through three intersecting edges.

C.
Slice the prism such that the plane is perpendicular to the base.

D.
Slice the prism such that the plane cuts through five of the six faces.

Answers

Answer:

D.

Step-by-step explanation:

In the picture attached it can be seen that if the plane cuts a right rectangular prism through five of the six faces, a pentagon is created. The picture is just an example, any five faces are possible to create a pentagon

Tamanika got a raise in her hourly pay, from $15.50 to $17.36. Find the percent increase​

Answers

Answer:

12%

Step-by-step explanation:

The required percent increase is 12%

Tamanika got a raise in her hourly pay, from $15.50 to $17.36

What is percentage?

percentage is defined as, composition of something out of whole inbounds of 100.

since = 17.36 - 15.50/15.50 x 100
= 1.86/15.50 x 100
= 0.12 x 100
= 12

Thus the required percent increase is 12%.

Learn more about percent here:
https://brainly.com/question/14699403

#SPJ2

Which shape fits the description below?


A figure with at least one pair of parallel sides.





A. X

B. Z

C. X and Y

D.Y

Answers

Answer:C, X and Y

Step-by-step explanation:

I just took the test

PLEASE HELP ME QUESTION IS AT THE BOTTOM OF THE PICTURE
A 28 and 45
B 79 and 88
C 19 and 45
D 28 and 17

Answers

Answer:

A 28 and 45

Step-by-step explanation:

So keep in mind that columns must add up to the total numbers, and rows must add up to their total numbers.

We know that what goes in the box canoeing + swimming is

x + 43 = 71.

It needs to add up to 71!

x = 71 - 43 = 28

We know that what goes in the box no swimming + no canoeing is

34 + y = 79

It needs to add up to 79.

y = 19 - 34 = 45

So the answer is A. 28 and 45.

Now, I did this with the columns, but you could easily do this with the rows and get the same result!

Other Questions
what is the degree of x^4-3x+22 How does the American work week compare to the rest of the world? Is this better for US or them? Defend your answer with facts. EquationsWhat is the solution of the system of linear equations?-3x + 4y = -182x - y = 7(-2,-3)(-2,3)(2, -3)(2, 3) what is the area of the circle when the radius is 5 How does the narrator repeating My favorite at the beginning of every paragraph contribute to the story? (My favorite things by joy cowley) If 14 moles of Oxygen burn how many moles of water are created? *2C2H6+7024CO2 + 6 H2OA) 12 mol H20B) 3.5 mol H20C) 3 mol H20D) 42 mol H20 2x +6 = 8xwhat are the values of x here? can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Please help ASAP will mark brainliest Dextra Computing sells merchandise for $15,000 cash on September 30 (cost of merchandise is $12,000). The sales tax law requires Dextra to collect 5% sales tax on every dollar of merchandise sold. Record the entry for the $15,000 sale and its applicable sales tax. Also record the entry that shows the payment of the 5% tax on this sale to the state government on October 15. View transaction list Journal entry worksheet Record the cost of September 30th sales. Note: Enter debits before credits Date General Journal Debit Credit Sep 30 Record entry Clear entry View general journal Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG John and Ellen bought a big pizza. Ellen ate 2/4 of the pizza and John ate 1/3 of the pizza. How much did they eat all together? How much was left over? (Hint: 12 is the Lowest Common Denominator).(1/4 was wrong plss helppp) The following linear programming problem has been written to plan the production of two products. The company wants to maximize its profits. LaTeX: X_1=X 1 = number of product 1 produced in each batch LaTeX: X_2=X 2 = number of product 2 produced in each batch MAX: LaTeX: 150\:X_1+250\:X_2150 X 1 + 250 X 2 Subject to: LaTeX: 2\:X_1+5\:X_2\le2002 X 1 + 5 X 2 200 LaTeX: 3\:X_1+7\:X_2\le1753 X 1 + 7 X 2 175 LaTeX: X_1,\:X_2\ge0X 1 , X 2 0 How much profit is earned per each unit of product 2 produced? Can someone plz help plz brainliest & points!i need help with math asap, show work too if possible :) Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) Poems are often ambiguous because _____.