What is Ependymal cell?

Answers

Answer 1

Answer:

Explanation: Ependymal cell is a type of neuronal support cell the forms the epithelial lining of the brain ventricles in the brain and the central canal of the spinal cord ependymal cells similar to all other neuroglia, are derived from a layer of embryonic tissue known as neuroectoderm.

Answer 2

Ependymal cells are ciliated-epithelial glial cells. It develops from radial glia alongside the surface of the ventricles of the brain and spinal canal.

What is the function of Ependymal cells?

The main role of Ependymal cells is formation of CSF.

The CSF refers to cerebrospinal fluid. It is done by movement of sodium ion, chlorine ion and bicarbonate ion from blood to ventricles of brain.

Inside ventricles of the brain, collection of ependymal cells and capillaries together i.e., the tela choroidea form choroid plexus, which produces the CSF.

Thus, Ependymal cells are involved in formation of CSF.

For more details regarding Ependymal cells, visit:

https://brainly.com/question/3233193


Related Questions

Which of the following properties is the temperature at which a liquid turns to gas? (3 points)
оа
Magnetism
Ob
Thermal conductivity
ос
Melting point
Boiling point
Od

Answers

thermal conductivity

Answer:

Boiling point

Explanation:

I did the test

The medical term ____________________ describes a pus-filled lesion on the eyelid resulting from an infection in a sebaceous gland.​

Answers

Answer:

the medical term is hordeolum

Which of the following is NOT a factor of sustainability?
Group of answer choices

economics

ethics

biodiversity

natural capital

solar energy

Answers

Answer:

natural capital

HOPE IT HELPS!

PLS MARK AS BRAINLIEST!!!

Which location is least likely to experience a volcanic eruption? Α. an island hot spot, such as the island of Hawaii B. Hamilton County on the plains of central Texas с. a convergent boundary, as in the Ring of Fire D a volcanic island arc, such as the Aleutian Arc in Alaska

Answers

Answer:

i think that the answer is B. Hamilton County on the plains of central Texas i took the test

Explanation:

Hamilton County on the plains of central Texas is least likely to experience a volcanic eruption. Therefore, option (B) is correct.

What are volcanoes?

Molten rock and gases stored under the surface erupt through a volcano, generating a hill or mountain.

Active, inactive, or extinct volcanoes. Active volcanoes are likely to erupt again. Dormant volcanoes may erupt again. Extinct volcanoes won't erupt.Magma collects inside active volcanoes. The magma chamber's pressure forces it through rock channels and onto the planet's surface.

Volcanic eruptions can be violent or slow-moving. Volcanoes erupt through vents on the sides or a primary entrance at the top. The volcano's morphology depends on eruption rate and magma chemistry. Land and sea volcanoes exist. As lava cools and hardens, underwater volcanoes build mountains and ranges. When volcanoes rise above the ocean, they create islands.

Learn more about volcano, here:

https://brainly.com/question/18058649

#SPJ5

which type of soil is likely to be found in horizon E

Answers

Answer:

A layer of pale,Sandy soil lacking clay and iron is likely to be found in horizon E

Answer:

bedrock

Explanation: A layer or bedrock is the type of soil is likely to be found in horizon E. Hence the correct answer is option A among the options. The bed rocks can be regarded very hard and it cannot be breakable.

if a short sequence of dna reads 3'TAACGTCCAGGCAAA5', what is the complementary sequence in the other strand of dna g

Answers

Answer:

5' ATTGCAGGTCCGTTT 3'

Explanation:

Complimentary strands of DNA run anti-parallel to each other, the ends facing in opposite directions.

The complimentary base pairs for DNA are:

A=T and C=G and when finding the complimentary strand these pairs are only paired with each other.

If tall is dominant over short, and yellow seed is dominant over green, how would you write the genotype of a pea plant that is heterozygous for tall, and that produces yellow seeds

Answers

Answer:

The answer has been written in paper and the image of the paper has been attached. Feel free to raise any doubt.

C. If you combined the elements in the product of this reaction, what type of

reaction would it be? Hint: What is the reverse of the equation you just

balanced? (1 point)

Answers

Answer:

Reversible reaction

Explanation:

If the elements of the product combine together in a chemical reaction, this reaction is called reversible reaction because the reaction moves in backward  or reverse direction. For example, if acid i. e. HCl combine with base i. e. NaOH which are the reactants, it produces two products salt (NaCl) and water (H2O). If salt (NaCl) and water (H2O) combine again with each other, it produces acid i. e. HCl and base i. e. NaOH, such type of reaction is called reversible reaction.

Question 3 (1 point)
During DNA replication, one of the new strands of DNA is synthesized continuously.
The other strand is synthesized as a number of separate fragments of DNA that are
subsequently linked by DNA ligase. Why does this occur?

- RNA primers only anneal to one of the parental strands of DNA.

- DNA polymerase III only synthesizes DNA in the 3' - 5' direction.

- DNA polymerase III only synthesizes DNA in the 5'-3' direction.

- One of the parental strands is unwound slower than the other by helicase.

Answers

Answer:

DNA polymerase III only synthesizes DNA in the 5'-3' direction.

Explanation:

DNA replication is an important phenomenon for every living cell. It is the process whereby the double-stranded DNA is doubled to form two new separate double strands. In order for DNA replication to occur, the double strand of the DNA molecule must first be unwound by an enzyme called DNA HELICASE. This gives two separate single strands, which individually acts as a template for the newly synthesized strands.

DNA polymerase III is the enzyme responsible for synthesizing new DNA strand by pairing complementary nucleotides to the old strands it attaches to. However, one of the old strands called LEADING STRAND runs in the 3'-5' direction while the other strand called LAGGING STRAND runs in the 5'-3' direction.

DNA polymerase III only attaches to the 3' hydroxyll end of the DNA and synthesizes new strand of DNA in the 5'-3' direction. Since the lagging strand runs in 5'-3', it is synthesized in small separate fragments called OKAZAKI FRAGMENTS which are later joined together by an enzyme called LIGASE.

N.B: As DNA polymerase synthesizes DNA strand on the leading strand(5'-3'), it is moving in an opposite direction of the lagging strand. Hence, it has to detach and come back to synthesize on the lagging strand. This causes the lagging strand to be synthesized discontinuously.

A red flower producing snapdragon plant is crossed with a white flower producing snapgragon plant. Resulting F1 generation is crossed with one another to produce F2 generation.

This is incomplete dominance of genes.

Q1 What type of a breeding is this? (monohybrid, dihybrid or interspecific)

Q2 Draw a genetic chart to show P, F1 and F2 generations clearly indicating genotypes, phenotypes and generations.



Answers

Answer:

See the answer below

Explanation:

1. This is an example of monohybrid breeding. A monohybrid breeding is the type of breeding that involves parents with a pair of contrasting characters. On the other hand, a type of breeding involving a single gene is what is known as monohybrid breeding.

2. When a red flower snapdragon is crossed with a white flower snapdragon, the resulting offspring are usually pink - an indication of incomplete dominance of the gene responsible for flower color. Assuming the red flower's genotype is AA and that of the white flower is aa:

                       AA      x      aa

                 Aa      Aa      Aa      Aa

F1 genotype = all Aa

F1 phenotype = pink flower

At F2:

                          Aa      x      Aa

                 AA         2Aa           aa

F2 Genotype/phenotype:

       1AA - red color

       2Aa - pink flower color

        1 aa - white flower color.

which particles is the fundamental unit of all matter in both living and nonliving

Answers

Answer:

atoms

Explanation:

all things in the universe are made of atoms and they are considered the fundamental unit of matter.

non-living things are composed of different compounds and molecules.

living things are made of cells, and cells themselves are made of different molecules. So living things are also made of atoms.

1. A star is 520 light years from Earth. During what event in history did the
light now arriving at Earth leave the star?

Answers

Answer:

A light year is the distance which is equal to 9,460,730,472,580.8 km, so:  

= 4.91957985 X [tex]10^{15}[/tex]km  

which is distance travels by the light.  Now what time it takes light to travel distance we found.  

A year has 365.25 days, so,

[tex]1 (\frac{365.25)}{1 year}) (\frac{24}{1 day}) (\frac{3600 s}{1 hr} )[/tex] = 31557600 seg/year

The light speed in the space is equal to 299,792.458 km/s, so:  

4.91957985 x [tex]10^{15} (\frac{1 seg}{29792.458}) \frac{1 year}{31557600}[/tex] = 520 years

if today, August, 2020, then

2020 - 520 = 1500

Spanish and Portuguese spread out over the southern part of the Western Hemisphere and bring in America brought to Spanish colony of Santo Domingo in year 1500.

Therefore, during the  period 1499 AD Columbus discovered JamaicaA light-year is a distance traveled by light in space during a period of one year from a celestial object to another celestial object. The distance between stars and Earth is 520 light-years. So, the light leaving the star is 520 years ago. The present year is 2019. Light from the star left 520 years ago. The time period on Earth is,

[tex]t=2019-520\\ t=1499 AD[/tex]

Learn More:https://brainly.com/question/8244352

What cell feature is used by scientists to classify an unknown cell as prokaryotic or eukaryotic?

Answers

Answer:

Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes, but a eukaryotic cell is typically larger than a prokaryotic cell, has a true nucleus (meaning its DNA is surrounded by a membrane), and has other membrane-bound organelles that allow for compartmentalization of functions.

Explanation:

Hope this helps ;)

Biochemical and genetic experiments have demonstrated that the _________ of tRNA are important for recognition by its cognate aminotransferase-tRNA synthetase.

Answers

Answer:  Acceptor stem and anticodon loop.

Explanation:

Transfer RNA (tRNA) is a small RNA nucleic acid involved in protein synthesis (translation). Each tRNA molecule has two important areas:

A region of trinucleotides, called the anticodon A region where a specific amino acid binds.

During translation, the ribosome reads the sequence of the mRNA in groups of three bases to assemble the protein. So, in the mRNA chain there are codons, set of three bases, which determine the amino acid to be added to the peptide chain. The tRNA transfers the amino acid to the ribosomes, and then arranges them along the messenger RNA (mRNA) molecule. Then, the tRNA must have an anticodon that is complementary to the codon. Each type of tRNA is specifically combined with 1 of the 20 amino acids to be incorporated into proteins.

This means, during translation, each time an amino acid is added to the growing chain, a tRNA molecule is formed whose base pairs have a complementary sequence with mRNA molecule, ensuring that the appropriate amino acid is inserted into the protein. So, tRNA is a key link between RNA transcription and the translation of that RNA into protein. On the other hand, aminotransferases are enzymes responsible for attaching amino acids to the 3ʹ‐end of cognate tRNAs.

The acceptor stem is the site of attachment of amino acids to tRNA, and anticodon loop is the site of tRNA that is complementary to the codons found in mRNA (that determine the amino acid that will be added) This means, both parts are important for recognition, because the acceptor stem is where the amino acid is, and the anticodon loop ensures that the appropriate amino acid is inserted into the protein.

Which is incorrect descriptions of the genetic event initiated by the HIV reverse transcriptase (RT) upon the HIV infection?
a. RT catalyzes initial synthesis of ssDNA using viral genomic RNA as the template.
b. The first RNA template is degraded after ssDNA synthesis.
c. The whole process is completed after synthesis of dsDNA.
d. tRNAs are adopted as the first primers.
e. None of these

Answers

Answer:

e. None of these

Explanation:

The immune deficiency viruses (HIV) are retroviruses that use a reverse transcriptase (RT) enzyme to produce a single-stranded DNA (ssDNA) from an RNA template. The reverse transcription allows retroviruses to replicate their genetic material, which is integrated into the host's genome as a double-stranded linear DNA molecule in a similar way to the mechanism of insertion used by endogenous retrotransposons. The synthesis of DNA is started by cellular tRNAs (tRNA3Lys) that are packaged into the virion. After reverse transcription, the HIV DNA enters the nucleus of CD4 immune cells (also known as CD4+ T cells), and then it integrates into the genome to coopt the host's cell machinery for its own replication.

Without this, many cycles such as the water cycle and photosynthesis would not exist. What could all these cycles not exist without?

Answers

Answer:

This question appears incomplete

Explanation:

This question appears incomplete. However, one similar substance that, if missing, many cycles (particularly the two cycles/processes provided in the question) will not exist/proceed is the sun/sunlight.

In the water cycle for instance, if there is no sun/sunlight, there will be no heat to allow for evaporation of water from the water-body (ocean, sea, stream or lake) hence there will be no cloud of water droplets in the atmosphere. The implication of this is that, the first process of the water cycle will not proceed, hence the cycle will not exist.

During photosynthesis, carbondioxide reacts with water in the presence of sun/sunlight to produce glucose and oxygen. The absence of sun in this reaction will not lead to the production of glucose which is the useful product of photosynthesis for plant.

From the explanation above, it can be deduced that the absence of the sun/sunlight will prevent the two cycles from existing.

As a substance is eaten, trace its path through the digestive system. Include one of the basic processes each step of the way: digestion, absorption, motility, secretion, and excretion.

Answers

Answer:

....... motility

Explanation:

what are 3 major functions of the femur?

Answers

Answer:

The femur is the longest bone in the human skeleton. It functions in supporting the weight of the body and allowing motion of the leg. The femur articulates proximally with the acetabulum of the pelvis forming the hip joint, and distally with the tibia and patella to form the knee joint.

Explanation:

Holding the body weight once standing and moving. People are being stabilized as they move. Connecting the hips and knees' muscles, tendons, and ligaments to the rest of your body. These are three functions of femur.

What is femur?

The femur is the bone in the thigh. It is person's body's longest and strongest bone. It is an essential component of the ability to stand and move.

There can be many functions of this bone, some are listed below:

Hold the body weight.Stabilize the body while moving.Connecting hip and knees.

Thus, above mentioned are three functions of femur.

For more details regarding femur, visit:

https://brainly.com/question/3264785

#SPJ2

Put the vocabulary words in order from largest level of organization to smallest. Reorder answers 1. Population Reorder answers 2. Organism Reorder answers 3. Organ Reorder answers 4. Atom Reorder answers 5. Biosphere Reorder answers 6. Species Reorder answers 7. Organ system Reorder answers 8. Community Reorder answers 9. Cell Reorder answers 10. Ecosystem Reorder answers 11. Organelle Reorder answers 12. Tissue Reorder answers 13. Molecule

Answers

Answer:

The level of organization in order from largest to smallest is;

1. Biosphere

2. Ecosystem

3. Community

4. Population

5. Species

6. Organism

7. Organ system

8. Organ

9. Tissue

10. Cell

11. Organelle

12. Molecule

13. Atom

Explanation:

All living things on Earth are arranged in an hierarchical level of organization. The order in descending way is as follows:

1. Biosphere- Biosphere refers to the part of the Earth that constitutes all living organisms in interaction with their environment. It is the total of all ecosystems on Earth.

2. Ecosystem: Ecosystem refers to a group of living organisms i.e plant, animal and microbes interacting with each other and their abiotic environment e.g water, air etc. An ecosystem comprises of several communities.

3. Community- Community refers to a group of organisms interacting with each other at a particular time and habitat. A community is made up of two or more populations.

4. Population- Population refers to a group of organisms of the same species living together in the same habitat and capable of interbreeding.

5. Species- A species is a group of organisms usually with the same appearance and capable of producing fertile offsprings by interbreeding.

6. Organism- An organism is an individual living thing i.e. plant, animal, microbe. An organism is made up of several organ systems that work together to make it whole.

7. Organ system- Organ system refers to a group of organs working in an interconnected manner to perform certain functions in an organism.

8. Organ- An organ is a structure in an organism that performs a specific function.

9. Tissue- A tissue is a group of cells working together for the same purpose.

10. Cell- A cell is the basic and fundamental unit of life, which is the building block of all living organisms.

11. Organelles- An organelle is a specialized structure in a cell that performs specific functions. e.g. nucleus, mitochondria etc.

12. Molecule- A molecule is the smallest unit of a chemical compound responsible for the chemical identity of that compound. A molecule is made up of two or more atoms chemically bonded together.

13. Atom- An atom is smallest indivisible unit of mattter that partakes in chemical reactions. Atom is considered the smallest unit of matter.

Answer:

:)

Explanation:

According to kirk smith a professor of environmental health at the university of california berkley indoor fires increase risks of pneumonia tuberculosis lung cancer and low birth weight in babies born of women expose during pregnancy. What simple solution is being widely promoted to reduce the risk of death?
a) preparing meals using solar cookers.
b) switching from wood to burning crop waste as a fuel source.
c) adding more windows to houses as a source of ventilation.
d) passing a green tax to make homeowners pay for their pollution.
e) providing asthma inhalers to children under the age of 12 years.

Answers

Answer:

preparing meals using solar cookers.

Explanation:

solar cookers  radiates at low rates.Therefore the most of the nutrients in the foods are conserved.Thus most micro nutrients for biochemical activities are retained. Vitamins which can not withstand high temperature are preserved.

Most importantly carcinogens which are usually associated with high heat foods are avoided ,when cook with low heat of solar cookers

The solar cooker is smoke free,therefore irritation of the lungs,lung cancer associated with high heat  cookers is avoided.

Specifically,local Mayan women exposed to high heat smoke cookers, suffers lung cancer,and those with pregnancy gives to infants with low birth weights. Children exposed to theses high heat also experienced acute lower respiratory infections.

Thus the smokeless,low heat solar cooker is safer.

what is sexual reproduction

Answers

Answer:

See explanation below...

Explanation:

Sexual reproduction is a type of reproduction that involves a complex life cycle in which a gamete with a single set of chromosomes combines with another to produce an organism composed of cells with two sets of chromosomes.

Best Regards!

Answer:

the production of new living organisms by combining genetic information from two individuals of different types (sexes). In most higher organisms, one sex (male) produces a small motile gamete which travels to fuse with a larger stationary gamete produced by the other (female).

In the quest to understand the basis of infertility in humans, researchers have identified a mutation in a gene associated with chiasmata. This protein normally acts to promote homologous recombination.Why might a defect in homologous recombination have consequences for fertility?A. The chiasmata halts the whole process of meiosis, if crossover do not form properly.B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregationC. A checkpoint requires a certain level of genetic variability for meiosis to proceed.D. Chiasmata are the connections between the centromeres and the centromeres that pull them to each pole of the daughter cells.

Answers

Answer:

B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregation

Explanation:

Crossing-over is a unique phenomenon that occurs in the prophase I stage of meiosis I, where non-sister chromatids of homologous chromosomes exchange their chromosomal segment. The physical point where this exchange occurs is called CHIASMATA. Hence, a mutation that affects the gene associated with the chiasmata will affect the occurrence of crossing over or homologous recombination.

Crossing-over, through the formation of the chiasmata, is responsible for the physical alignment and proper segregation of chromosomes into gametes. Naturally, the chiasmata formed as a result of recombination during meiosis helps ensure that the chromosomes stay together until it is the right time to separate. This way, any chromosomal defect in the resulting gamete is prevented.

However, an error or defect in homologous recombination might give rise to gametes with chromosomal disorder, a condition known as ANEUPLOIDY i.e. missing or additional chromosomes in gametes. This can affect the fertility of the involved human.

A purebred tall pea plant is cross-pollinated with a tall, heterozygous pea plant. Use a Punnett square to determine the probability the offspring inherita
recessive short allele. (I point)
75%
25%
0%
50%

Answers

Answer:

0%

Explanation:

This question involves a gene coding for height in pea plants. The allele for tallness (T) is dominant over the allele for shortness (t). This means that allele T will be expressed over allele t in an heterozygous state.

A purebred tall plant will possess genotype: TT while a heterozygous tall plant will possess genotype: Tt. The two parents will produce the following gametes:

TT- T and T

Tt- T and t

Using these gametes in a punnet square (see attached image), the following offsprings with genotypes: TT and Tt in a ratio 1:1 will be produced.

TT offsprings are purebreed tall while Tt offsprings are heterozygous tall. Hence, based on the question, no offsprings of this cross will possess the recessive genotype (tt). This means that 0% of the offsprings of this cross will be short.


Which of the following groups gets energy directly from the grass it eats?

Answers

Answer:

herbivores

Explanation:

i think it's herbivores because "herb"ivores get energy when eating grass or any other herb.

I need help FAST!! U have too match the letters with the #.!

Answers

8 B

9 B

10 D

11 C

12 C

13 B

14 A

15 A

16 C

17 A

18 A

19 D

20 A

21 D

22 D

what type of molecule do plant cells use for long term energy storage

Answers

Answer:

ATP

Explanation:

In plants, energy is stored in the form of ATP and NADPH. Energy is produced in the presence of light it is in the thylakoids and mitochondria.

ATP: Adenosine triphosphate

NADPH:  nicotinamide adenine dinucleotide phosphate hydrogen

Which is a feature of a tonic receptor? Select one: a. The action potential occurs when there is a change in response to a change in condition. b. For this receptor, the stimulus begins with a burst of action potentials. c. They are normally inactive. d. When the stimulus changes the action potential generation changes. e. Provides information about the rate and change of the stimulus. f. The action potential is generated for a short time period.

Answers

Answer:

For this receptor, the stimulus begins with an explosion of action potentials.

that would be the correct option.

Explanation:

A tonic receptor is one that is activated when the action potentials were maintained over time and during the signaling of the receptor.

Tone receptors require continuous stimulation over a period of time to trigger a response and deliver it to the central nervous system.

It keeps the nervous system constantly active in the environment that surrounds it.

They are slowly adaptable, an example of these receptors are the merkel and ruffini receptors.

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG

Answers

Answer:

a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA

Explanation:

The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20  nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:

Schematically:

The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:

5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'

The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:

3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'

Saguaro cacti are very tall cylindrical plants that usually have two L-shaped arms, one on each side. Suppose you lived in southern Arizona where the Saguaro cactus is common and you happen to have one growing in your yard. Your Saguaro has two arms but one is longer than the other. Now, assume that arm length in these cacti are controlled by a single gene with arms of the same length (A) being dominant to arms of different lengths. What is the genotype of your cactus

Answers

Answer:

The genotype is aa. Sorry if I am wrong.

Explanation:

I put the answer in the wrong spot xD

Why do you think premenopausal women need more iron than
men of the same age?

Answers

Answer:

Women need more iron than men to make up for the amount of iron they lose in their menstrual period.

Explanation:

Answer:

Premenopausal women shed blood as part of menstruation every month, which lowers the level of iron in the body. So, they need more iron than men and are also at a greater risk for this nutritional deficiency.

PLATO

Explanation:

Other Questions
The entire graph of the function h is shown below write the domain and range of h using interval notation. Which statement describes one feature of Rutherford's model of the atom?O The atom is mostly empty space.O The atom cannot be divided into smaller particles.O Electron clouds are regions where electrons are likely to be found.O The electrons are located within the positive material of the nucleus. A car is traveling to the right with a speed of 2.0\,\dfrac{\text m}{\text s}2.0 s m 2, point, 0, start fraction, start text, m, end text, divided by, start text, s, end text, end fraction on an icy road when the brakes are applied. The car slows down with constant acceleration for 3.0\,\text m3.0m3, point, 0, start text, m, end text until it comes to a stop. How long does it take the car to slide to a stop? Marigold Corp. issues $220,000, 20-year, 8% bonds at 104. Prepare the journal entry to record the sale of these bonds on June 1, 2020 the sum of the prime divisors of 2001 is a) 55, b) 56, c) 670, d) 671, e) 2001 verb of search in english y x1 x210 1 1611 5 1115 5 1415 9 1120 7 123 11 827 16 732 21 3a. Using technology, construct a multiple regression model with the given data.b. Interpret the meaning of the values for b1 and b2. why does human want change over a period of time ? Select the correct answer from the drop-down menu.make a reliable argument more persuasive. how many carbon atoms are in .650 gram tablet of aspirin (C9H8O4)? kind of urgent!! Please describe a real-world scenario in which it would be important to know how to apply scale factors. there are 12 eggs in one box and 12 boxes in one crate. how many eggs are in a shipment of 24 crates Suppose that the four firms are colluding by acting like a monopolist, with each firm producing one-fourth of the market output. If one of the firms cheats on the cartel agreement and produces an additional unit of output, the profits of each of the compliant firms go from: Describe the subject and one central theme of "A Poem of Changgan" by Li Po. Cite evidence from the poem to support your response Where did early man often settle?Multiple choice question 1. Near water for fish. 2. Near sources of large land mammals for meat. 3. Near sources of warmth. redacta una historia en que se demuestre el valor de la amistad, segn lo que aprendiste a travs de la lectura El Profeta de Gibran Jalil Gibran. Luego, realicen una breve actuacin, ante tus compaeros de curso What is the nearest 100 of 1730 Given a sample of 35, what is the sample standard deviation of a pair of jeans if the 90% confidence interval is [37.14, 42.86] Under the Tang, religion was A. considered a dangerous element in society and was banned. B. tied to the state and all citizens were required to practice Daoism. C. tolerated, with the exception of Zoroastrianism, which was repressed. D. relatively free, and different religions flourished. 15 POINT!!!!!!!!!!!!!!!!!!!! Using the graph of f(x) and g(x), where g(x) = f(kx), determine the value of k. Graph of two lines. f of x passes through 2, 0 and 3, 2, and g of x passes through two thirds, 0 and 1, 2. 3 one third negative one third 3