Answer:
B. Energy is never recycled.
Explanation:
Chemical nutrients and energy tend to flow in the same direction for most of an ecosystem. The big difference is that the chemical nutrients are recycled in the ecosystem while the energy is lost from the ecosystem to the universe at large. Energy in any ecosystem comes from the Sun.
Why do your mitochondria come from your mom?
Answer:
the mitochondria in mammalian sperm are usually destroyed by the egg cell after fertilization.
Explanation:
What does uranium do to the environment
What is the answer pleaseeee
Answer: c
Explanation:
What is molting????????
A dragonfly in its radical final moult, metamorphosing from an aquatic nymph to a winged adult.
In biology, moulting (British English), or molting (American English), also known as sloughing, shedding, or in many invertebrates, ecdysis, is the manner in which an animal routinely casts off a part of its body (often, but not always, an outer layer or covering), either at specific times of the year, or at specific points in its life cycle.
Moulting can involve shedding the epidermis (skin), pelage (hair, feathers, fur, wool), or other external layer. In some groups, other body parts may be shed, for example, wings in some insects or the entire exoskeleton in arthropods.
What consists of all the living organisms in an area and the
non-living aspects of the environment?
a Ecosystem
b Community
C Population
Answer:
a. Ecosystem
Explanation:
Ecosystem
An ecosystem consists of all the living things and nonliving things interacting in the same area.
Protein in your diet provide what necessary substances to repair muscles?
The muscle damage initiates a repair process in which certain hormones, along with the macronutrient protein, synthesize new satellite cells, which are used to repair the damaged muscle fibers. In other words, the role of protein is to help repair tissues damaged by exercise.
distinguish between absorption and reabsorption in the mammalian body
Answer:
Tubular reabsorption is the process that moves solutes and water out of the filtrate and back into your bloodstream. This process is known as reabsorption, because this is the second time they have been absorbed; the first time being when they were absorbed into the bloodstream from the digestive tract after a meal.
Explanation:
plz help me on science due today
Answer:
A
Explanation:
Wind is caused by inequal heating. As you should have learned, things expand when they get hot and contract when they get cold. So, the high pressure hot air flows into the low pressure cold air via wind.
why do snails like leaf litters
Answer:
They will eat the biofilm that grows on the leaves. My snails love my oak leaf litter, as do my loaches. They eat the film off them.
Explanation:
What can occur nitrogenous bases do not pair correctly?
Answer:
Incorrectly paired nucleotides cause deformities in the secondary structure of the final dna molecule.
Explanation:
AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.
Answer:
what?
Explanation:
Summarize the differences between early succession, mid-succession, and late succession?
Choose the mutation that you think has caused Calix’s calico fur coloring. Form a hypothesis to explain your reasoning. You will be able to revise your hypothesis as you collect more data. ( Ya'll i need a hypothesis )
The complete question is as follows:
Hypothesis Cas More Information: Here is a summary of the data, Mass of DNA Cat Res per Coll Mother Father Calix 1520 fg 1495 fg 1535 fg . The mass of an X chromosome is 40 fg. • Point mutations do not change the mass of DNA. • In chromosomal rearrangement, some daughter cells gain parts of chromosomes and some lose parts of chromosomes. • In nondisjunction, daughter cells gain a whole entire chromosome. Obe Exp Нур 는 Exp Point Mutation in Melosis Chromosomal Rearrangement Nondisjunction Choose the mutation that you think has caused Calix's calico fur coloring. Form a hypothesis to explain your reasoning. You will be able to revise your hypothesis as you collect more data.
Answer:
The correct answer is - non-disjunction.
Explanation:
Calix's calico has an X chromosome gene that determines the color of fur. One allele forms orange fur and the other give rise to black. In heterozygous give rise to orange patches on black.
Mother has autosome and 2-X chromosomes.
Mass of 2 X chromosomes will be
= 40*2
= 80fg
So mass of autosomes = 1520-80
= 1440fg
Mass of sex chromosomes in father is = 1495-1440
= 55fg
So the mass of Y=55-40
= 15fg
It is clear that the mass of DNA of Calix is exactly 15 more than DNA of the mother. So we can say that Calix has an entire Y chromosome in extra.
So the answer is non-disjunction.
The right option is - non-disjunction.
Information regarding Calix’s calico:It comprises of X chromosome gene that measured the fur color. In the case of heterozygous, it provides the increment with respect to orange that patches on black.
Since Mother has autosome and 2-X chromosomes.
So,
Mass of 2 X chromosomes should be
= 40*2
= 80fg
Now
The mass of autosomes should be
= 1520 - 80
= 1440fg
Now
Mass of s-ex chromosomes in father should be
= 1495-1440
= 55fg
Now finally the mass of Y is
= 55 - 40
= 15fg
Based on the above calculation, the mass of DNA of Calix should be 15 i.e. more than the DNA of the mother.
Learn more about the mutation here: https://brainly.com/question/8334911
What is the function of the DNA
Answer:the function is direction to build life
Explanation: i’m smart
Answer:
DNA is a information molecules.
It stores instructions for making other large molecules called proteins
these instructions are stored inside each of our cell.
distribution among 46 long structure called chromosomes
In subduction what plate would be on top and what plate would be on the bottom?
Answer:
oceanic plate would slide under the continental plate
Explanation:
continental is on top, oceanic on bottom
Answer:
When an oceanic lithosphere meets a continental lithosphere in a subduction zone, the oceanic plate always goes under the continental plate. This is the rule because the rock making up an oceanic lithosphere is denser than in a continental lithosphere.२०२० मे
How do B cells know when to make antibodies?
A.) They are alerted by Helper T cells.
B.) They are always making antibodies just in case that pathogen is present.
C.) They are alerted by Macrophages.
D.) B cells will simply find the pathogen in the body and immediately begin making
antibodies to fight the pathogen.
Answer:
A) They are alerted by Helper T cells.
Genetic information is stored and transmitted within.
A. nucleic acids.
B. proteins.
C. amino acids.
D. sugars.
Answer:
A. nucleic acids
Answer:
A. nucleic acids
Explanation:
Please help me. Thank you :()
Fossils and Evolution On Study Island
A team of scientists are studying three different layers of sedimentary rock to learn about a particular reptile species. In the layer of rock that is closest to the Earth's surface, the reptiles' teeth fossils are found to be short and straight. In the layer below, the reptiles' teeth fossils are found to be long and straight. In the layer below that, the reptiles' teeth fossils are found to be long and curved.
Based on this information, the reptiles today most likely have
A.
long, straight teeth.
B.
no teeth.
C.
long, curved teeth.
D.
short, straight teeth.
Answer: short, straight teeth
Explanation: study island
Vascular resistance is due to friction between blood and the walls of the blood vessel. Which of the following causes low vascular resistance?
obesity
dehydration
high blood pressure
cholesterol levels within normal range
Answer:
Cholesterol levels within normal range
Explanation:
Vascular resistance is due to friction between the blood and the walls of the blood vessel, and cholesterol levels within the normal range can cause low vascular resistance, which is the last option.
What is vascular resistance?Vascular resistance is the resistance to blood flow in the blood vessels, which is determined by the diameter of the blood vessels, blood viscosity, and the length of the blood vessels, so when blood flows through the blood vessels, it experiences frictional forces due to the interaction between the blood and the walls of the blood vessels, obesity, dehydration, and high blood pressure can all contribute to increased vascular resistance.
Hence, the correct answer is that cholesterol levels within the normal range can cause low vascular resistance, which is the last option.
Learn more about vascular resistance here.
https://brainly.com/question/12877367
#SPJ2
Which species has the MOST RECENT common ancestor with the ROBIN?
Hagfish
(outgroup)
Salmon
Jaws
Frog
Keratinous
scales
Lizard
Lungs:
Four limbs
Alligator
D
Gizzard
Feathers
Claws
Robin
or nails
G
Rat
Fur;
Mammary
Glands
Gorilla
Time
O Lizard
O Salmon
O Gorilla
help asap please!
science
Complete the table below to show the difference between active and passive transport. Put a “X” in boxes that satisfy the statement.
Answer:
Active transport:
requires energymolecules move from low to high concentration sidesNa+ and K+ move by active transportSimple diffusion:
molecules move from high to low concentration sidesmolecules pass between lipids small non-polar and polar moleculesFacilitated diffusion:
molecules move from high to low concentration sidesinvolves channel proteinsmove large moleculesExplanation:
Simple Diffusion is the pathway of only small molecules that freely move through the membrane by momentary openings produced by the lipids' movements. Diffusion is a slow process that requires short distances and pronounced concentration gradients to be efficient. An example of diffusion is osmosis by which water is the transported molecule. Facilitated diffusion is the transport of hydrophilic molecules that can not freely cross the membrane. Channel protein and many carrier proteins are in charge of this transport. When uncharged molecules cross the membrane, they do it according to their concentration gradients, going from the more concentrated side to the lower concentrated one. When ions need to cross the membrane, the process depends on an electrochemical gradient. Glucose is an example of a hydrophilic protein that gets into the cell by facilitated diffusion.Simple diffusion and facilitated diffusion are both passive transport processes because they only depend on electrochemical gradients, so they do not need any energy to occur.
Active transport is the transport of molecules that move against the electrochemical gradient, so it does need energy to happen. Molecules move from the lower concentration side to the higher concentration side of the membrane. Carrier proteins are in charge of active transport. The needed energy might proceed from the ATP molecules or the membrane's electric potential. An example of molecules moved by active transport are the Na and K.In Active transport, molecules or ions move against the concentration gradient by using energy from ATP.
What is Membrane transport?The transfer of molecules across the plasma membrane into or out of the cell.
There are two types of membrane transport,
1. Passive transport:
When molecules move along the gradient. It can be of two types,
Simple diffusion (via phospholipids)Facilitated diffusion (via channel protein)2. Active transport:
When molecules move against the concentration gradient, they require energy. Energy is given by ATP.
Therefore, in Active transport, molecules or ions move against the concentration gradient by using energy from ATP.
Learn more about Membrane transport:
https://brainly.com/question/13220002
Recycling of car batteries can help to do what to lead?
All you have to do is give me some inspiration and I'll give points cause I would really like some inspiration please
Answer:
ZOOM PLZ COME WE R BORED
MEETING ID 798 4170 2552
PASSWORD:XCNeV3
Explanation:
Having trouble with this textbook question. Can anyone help me out?
"You learned that the length of the cell cycle varies between cell types. Predict which of the three phases of the cell cycle varies"
Answer:
Oh well Thx that could really help
necesito hacer una infografia en mi computadora y nose como pueden ayudarme
Answer:
Identify the audience for your infographic.
Collect your content and relevant data.
Choose your desired infographic template.
Download your template to PowerPoint.
Customize your infographic.
Include a footer with your sources and logo.
Add an embed code and Pinterest button, and publish it.
Explanation:
Rocky's class recently got pet turtles. When putting together the habitat, decomposers were added to
the soil, as well as some smaller organisms that turtles eat. Some students wanted to get "fake" plants
for the terrarium, but Rocky insisted that this would negatively affect the carbon and oxygen cycles.
Which of the following reasons support why Rocky is correct?
Carbon won't be removed from the air.
Photosynthesis won't occur.
The turtles won't be able to breathe.
All of these are correct.
Answer:
D. all of these are correct
Explanation:
I so sorry if I am wrong the answer
Many research studies have shown that different species may possess some of the exact same genes but show vastly different traits. How can that happen?
Answer:
Mutation can occur or the order in which these genes appear are in different order. Genetic variation can also occur.
An airplane flies from Minneapolis to Chicago in 62 minutes.
If it is 572,000 meters from Minneapolis to Chicago, what is the plane's average speed?
A. 2,000 m/s
B. 355 m/s
C. 154 m/s
D. 119 m/s
Answer:
154m/s
Explanation:
Average speed= distance(m)/time(sec)
Distance=572,000metres
Time=62×60=3720seconds
As=572000/3720=153.76aproximately154m/s
Why would breeders want to introduce mutations into a population?Single line text.
Short answers please
Answer:
Breeders can increase the genetic variation in a population by inducing mutations, which are the ultimate source of genetic variability
