Answer:
attracts pollinators
describe one piece of evidence represented by the contour line on the map that indicates the north side of chimney bluffs is steep?
Incomplete question. Attached is the image of the map below.
Explanation:
From the map, we could notice the contour lines around the Chimney Bluff areas are closely packed together. In other words, the spacing between the contour lines is narrower than those found in other locations.
This assertion is accurate because it is a standard practice in many maps to indicate the steepness of an area by having the contour lines in close proximity.
What are the 3 main functions of this organ system?
Answer: Circulatory system, Cardiovascular system, and Digestive system.
Explanation:
3. State and explain Chargaff's rules.
Answer: Chargaff's rules state that DNA from any species of any organism should have a 1:1 stoichiometric ratio (base pair rule) of pyrimidine and purine bases and, more specifically, that the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine.
Explanation:
HELP ME PLZZ I REALLY NEED HELP WITH THIS AND PLZZ EXPLAIN HOW YOU GOT YOU ANSWER WHEN YOU ARE DONE!!
Answer:
B.
Explanation:
The organ system is composed of multiple organs that work together to carry out a function.
Which of these groups contains single-celled organisms?
A. birds
В. plants
C. fungus
D. animals
Answer:
C. Fungus
Explanation:
The fungi kingdom includes both single cell and multicellular organisms. Single cell organisms in the fungi kingdom include yeasts and chytrids, or fossilized fungi. Most organisms within the plant and animal kingdoms are multicellular. The Largest Single-Celled Organism.
hope i helped
Answer:
C. fungus
Explanation:
Birds and animals are in the same category, and both have multiple cells.
Plants also have multiply cells.
And fungus can be single celled or multiple cells.
Hope this helps ya!!
help meeeeeeeeeeeeeeeee plz
Answer:
It would most likely be within the mantle. the mantle is in the interior of the earth;. So inner core.
Explanation:
define the term diffusion in your own words
Answer:
physical process of atoms or molecules moving apart within a gas or liquid.
Explanation:
Answer:
The act of a solvent going from high concentration gradient to low concentration gradient
Explanation:
I had this lesson last month
scientist have been measuring increasing levels of greenhouse gases in Earth's atmosphere. How do increasing levels affect the atmosphere?
Well, we have a book to write on this topic but imma explain it briefly plus simply.
Global warming emphasizes the environment with rising temperatures, water shortages, increased fire threats, droughts, weeds and pest attacks, severe storm damage and salt attacks, to name just a few.(In simple words)Now, we'd go briefly and discuss some common affects briefly :
Hotter days - The climate is getting more and more warmer and year 2015 was the hottest year ever record throughout the history. The Earth's temperature had already warmed by 1°C which is really dangerous. Rising sea levels - Rising sea levels due to climate change is the biggest problem causing natural calamities. Increased ocean temperatures are melting glaciers and ice caps all over the world. Melted ice increases the volume of water in our oceans. Warmer temperatures also result in the expansion of the water's mass, which causes sea levels to rise, threatening islands and coastal cities.More frequent and intense extreme weather - Extreme weather events like bushfires, cyclones, droughts and floods are becoming more common and more aggressive as a result of global warming.Hope it helps <3
Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis
Answer:
Answer D
Explanation:
just took the test.
hello I need help!!! did I get this right
Answer:
Yeah it is correct.
Explanation:
Things enter the cell through the cell membrane through either active or passive transport which can tell you that the cell membrane controls what goes in and out.
I believe so. I looked it up and it matched everything I found
In the two step cellular process of transcription and translation
(A) chromosomes line up and then are pulled to opposite ends of the cell.
(B) stem cells develop in embryonic cells, which then form adult tissue cells.
(C) the DNA double helix is separated and then replicated to form two strands of DNA.
(D) a DNA sequence is copied to form an RNA sequence, and then copied to form a protein.
Answer:
The answer is D
A is cell division, B is some stage of pregnancy, and C is DNA replication.
Diffusion takes place
Answer:
yes
Explanation:
brainliest ???
Please I beg someone to help me
Which most likely accounts for the increase in the number of male butterflies in the five years after the initial parasite problem?
A tropical wet climate exists in the United States only in
1 point
a. Oregon and Washington,
b. Florida.
c. Hawaii.
O d. California.
Answer:
C. Hawaii
Explanation:
Question: A tropical wet climate exists in the United States only in
a. Oregon and Washington,
b. Florida.
c. Hawaii.
d. California.
The answer you are looking for is C. Hawaii
Before cells divide, they must replicate their entire genome. Explain why
replication of the genome prior to cell division is important.
Each time a cell divides into two daughter cells, its full genome is duplicated; for humans and other complex organisms, this duplication occurs in the nucleus. This minimizes the incidence of errors (mutations) that may greatly affect the resulting organism or its offspring. ...
HOPE THIS HELPED <3
Answer:
In order for all of the cells in your body to maintain a full genome, each cell must replicate its DNA before it divides so that a full genome can be allotted to each of its offspring cells. If DNA replication did not take place fully, or at all, the offspring cells would be missing some or all of the genome.
Explanation:
a cell is placed in a isotonic solution. How does the cell maintain homeostasis in the environment ?
Answer:
If a cell is placed in an isotonic solution, there will be no net flow of water into or out of the cell, and the cell's volume will remain stable. If the solute concentration outside the cell is the same as inside the cell, and the solutes cannot cross the membrane, then that solution is isotonic to the cell.
Explanation:
Need Help Due in 5 min: Earth Science
Answers:
hurricane
snowstorm
tornado
flooding
Answer: a snowstorm would occur
Which refers to the sum of all the forces that act upon an object?
A. net force
B. absolute force
C. balanced force
D. positive force
Answer:
Net force
Explanation:
Net force is the vector sum of forces acting on a particle or body. The net force is a single force that replaces the effect of the original forces on the particle's motion. It gives the particle the same acceleration as all those actual forces together as described by the Newton's second law of motion.
Answer:
net force
Explanation:
Please help
Question is in photo
Answer:
the first one.
Explanation:
Why did the removal of wolves affect the entire Yellowstone ecosystem?
A. It changed the balance of many different interactions.
O B. The organisms in the ecosystem did not compete for resources.
C. Wolves were the only predators in the ecosystem.
D. The wolves were the only producers in the ecosystem.
HELP ME QUICKKK PLEASE
Answer:
A
Explanation:
Since Wolves were one of the main predators (not the ONLY one) prey started to over populate causing the vegetation population to decrease. Since the vegetation decreases so does the number of prey then as well as the number of predators.
The removal of wolves affecting the entire Yellowstone ecosystem is option "A" that is It changed the balance of many different interactions.
Here wolves act as a keystone species.
What are keystone species?A keystone species is an organism that enables represent an entire ecosystem.
Without its keystone species, the ecosystem would be dramatically distinct or stop existing altogether.
Keystone species have low functional tedium.
Thus, option "A" that is It changed the balance of many different interactions.
To learn more about keystone species click here:
https://brainly.com/question/6868621
how to write a narrative story?
Answer:
Start with action or dialogue.
Ask a question or set of questions.
Describe the setting so readers can imagine it.
Give background information that will interest readers.
Introduce yourself to readers in a surprising way.
Explanation:
Answer:
Narrative essays/stories are often anecdotal, experiential, and personal—allowing students to express themselves in a creative and, quite often, moving ways. So, in short, it's an essay about your life with details, events, etc.
Explanation:
Narrative essays/stories should include:
an introduction, plot, characters, setting, climax, and conclusion.must have a purpose; think of this as the thesis of your story.the essay should be written from a clear point of view; essays to be written from the standpoint of the author (you); however, this is not the sole perspective to be considered. Creativity in narrative essays oftentimes manifests itself in the form of authorial perspective. narrative essays are effective when the language is carefully, particularly, and artfully chosen. Use specific language to evoke specific emotions and senses in the reader. the use of the first person pronoun ‘I’ is welcomed; though it is welcomed it is not necessary—nor should it be overused for lack of clearer diction.have a clear introduction that sets the tone for the remainder of the essay. Do not leave the reader guessing about the purpose of your narrative; you are in control of the essay, so guide it where you desire (just make sure your audience can follow your lead).I hope that this helps you! I know it was a lot to read, but it's worth it. Have a nice night! :D
Why are animals renewable resources?
Answer:
They are renewable natural resources. They move round and round in cycles and never run out. When an animal like this cow eats a plant, it takes in nutrients. The nutrients are used in the animal's body and then many come out as waste, which returns the nutrients to the soil.
how does the law of conservation of energy apple to virbatioin
Answer:
As objects move around over time, the energy associated with them—e.g., kinetic, gravitational potential, heat—might change forms, but if energy is conserved, then the total will remain the same. Conservation of energy applies only to isolated systems.
Explanation:
‼️PLEASE HELP THIS IS MY LAST HOPE
List 6 amino acids found in turkey meat. Explain how those amino acids could be formed into a protein including an explanation of translation and transcription.
How carbon is uniquely suited to Form biological macromolecules give 3 reasons why
Answer:
Carbon atoms have four electrons of valance. This enables them to form strong covalent bonds with multiple materials. Carbon can also join with it, allowing it to form long chains or atomic rings on carbon.
hope it helps!
17. Match the major types of cancer with the types of cells they occur in
Adenocarcinomas
a. The lowest layer of the epidermis (skin)
Basal cell carcinoma
b. upper layers of skin, the lining of stomach, lungs,
kidneys
Squamous cell carcinoma
c. melanin-producing cells of the skin
Sarcoma
d. immune cells in the blood (T cells, B cells, and
bone marrow)
Leukemia and lymphoma
e. bones, fat, blood vessels, tendons, ligaments
Multiple myeloma
1. cells that produce fluids (breast, colon)
Melanoma
g. plasma cells (a type of immune cells)
The destruction of which transport vessel in the plant results in a faster death??
Answer:
All of the following are plant adaptations to life on land except ... D) The genes for the synthesis of transport proteins were destroyed. ... A) Xylem tracheids and vessels fulfill their vital function only after their death. ... 51) Ignoring all other factors, what kind of day would result in the fastest delivery of water and minerals to ...
Explanation: MARK BRAINLIEST
BIOLOGY, I need help on this one
This is a base deletion
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC
Momentum explains how _____ travels.
A.) sound
B.) heat
C.) both of these
D.) none of these
Answer:
I think D
Explanation: