what is the uses of forest​

Answers

Answer 1
We depend on forests for our survival, from the air we breathe to the wood we use. Besides providing habitats for animals and livelihoods for humans, forests also offer watershed protection, prevent soil erosion and mitigate climate change.
Answer 2

Answer:

Forests are increasingly managed for a variety of uses and values, often in combination. ... Forests and trees outside forests provide many different products, ranging from timber and fuelwood to food (berries, mushrooms etc.), fodder, and other non-wood forest products.


Related Questions

how do i explain this?

Answers

Answer:

Oxygen debt is a physiological phenomenon in which a person consume oxygen at fater rate that it replaced by new oxygen molecules.

As shown in the graph, oxygen debt occurs just after the end of exercise because oxygen is consumed at faster rate during exercise that leads to  increased respiration and body attempts to replace the used oxygen.

To overcome the problem of oxygen debt, a person should take rest that allows the body to replenish its oxygen supply.

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Which label in the graphic represents the energy that is released from glucose by cellular respiration?
Oxygen
Glucose
Energy stored as ATP
Carbon dioxide and water

Answers

Answer:

C) Energy stored as ATP

Explanation:

100% on edge

Which statement below correctly describes what the model shows? *
1​

Answers

Answer:

I reckon it's part D.

Explanation:

Cómo explicarías tu que el soporte vegetal es más importante que los animales en un ecosistema?

Answers

Answer:

Las plantas son productores primarios, mientras que los animales son consumidores

Explanation:

La cadena alimenticia está conformada por niveles tróficos donde la energía fluye desde los niveles basales representados por la base de la pirámide, hasta los niveles superiores (pico de la pirámide). De este modo, los organismos representan diferentes eslabones de acuerdo a su posición en la cadena alimenticia. En el primer nivel se encuentran los productores primarios como lo son, por ejemplo, las plantas y algas de ambientes terrestres y acuáticos, respectivamente, siguiendo por los consumidores primarios (por ejemplo, especies hervívoras), continuando sucesivamente por los consumidores secundarios, terciarios y cuaternarios (especies carnívoras), los cuales se encuentran en posiciones cada vez más altas de la pirámide. No obstante, es importante indicar que existen ocasiones donde los consumidores superiores (ya sea secundarios, terciarios y cuaternarios) se alimentan de especies situadas por debajo de diferentes niveles no consecutivos e incluso también de especies pertenecientes al mismo nivel trófico, con lo cual encajando en más de una categoría y dificultando su clasificación en la cadena.

3. Why are some potentially
renewable resources currently
nonrenewable resources?

Answers

Some potentially renewable resources are currently nonrenewable because... species are taken faster than they can reproduce.

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

In CaF2, the oxidation number of Ca is , and that of F is . In H2SO4, the oxidation number of H is , that of S is , and that of O is . In CaSO4, the oxidation number of Ca is , that of S is , and that of O is . In HF, the oxidation number of H is , and that of F is

Answers

Answer:

1. The oxidation number of Ca is 2, F is -1 in CaF₂

2. The oxidation number of H is 2, S is 6, O is -8 in H₂SO₄

3. The oxidation number of Ca is 2, S is 6, O is -8 in CaSO₄

4. The oxidation number of H is 1, F is -1 in HF

Explanation:

To get the oxidation number, we need to take the oxidation number of the whole compound 0. Then we need to know the oxidation number of the other elements and we need to take 'x' as the oxidation number of the unknown element.

Example:

In case of CaSO₄,

We can write an equation as-

CaSO₄ = 0

If we need to know the oxidation number of S

We can write the equation like this-

→2+ x+ (-2*4) = 0 (as we know the oxidation number of Ca is 2 as it has two electrons in its last shell which it gives to other elements to form bonds and the oxidation number of O is -2 as it takes 2 electrons to complete its outer shell)

→2+ x+ (-8) = 0

→2+ x- 8 = 0

→x- 6 = 0

→x = 6; which is the oxidation number of S

                       

The following are the oxidation numbers:

In CaF2, the oxidation number of Ca is +2, and that of F is -1.

In H2SO4, the oxidation number of H is +1, that of S is +6, and that of O is -2.

In CaSO4, the oxidation number of Ca is +2, that of S is +6, and that of O is -2.

In HF, the oxidation number of H is +1, and that of F is -1.

What is oxidation number?

Oxidation numbers are a way of representing the degree of oxidation (loss of electrons) or reduction (gain of electrons) of an element in a chemical compound. The oxidation number of an element is calculated based on the number of valence electrons (electrons in the outermost energy level of an atom) and the rules for assigning oxidation numbers.

In general, the oxidation number of an element is equal to the charge it would have if all the bonds in the compound were ionic (made up of positive and negative ions). This allows chemists to predict the behavior of elements in a compound and to balance chemical equations.

Learn more about oxidation number, here:

https://brainly.com/question/29257381

#SPJ2

what effect does smoking have on cilia.

Answers

Answer: The cilia sweep out mucus and dirt so your lungs stay clear. Smoking temporarily paralyzes and even kills cilia. This makes you more at risk for infection. Smokers get more colds and respiratory infections than non-smokers.

Explanation:

what is the answer to 9k=27

Answers

Answer:

K=3

Explanation:

We divide both sides by 9 which is 9k/9=27/9 then cancel 9 by 9 and by 9 once by 9 thrice.

Type 2 diabetes (insulin-independent diabetes) is a non-infectious disease. If not treated this disease is characterised by large fluctuations in the concentration of glucose in the blood Maltase is an enzyme that completes the digestion of starch in humans Molecules of maltase are bound to the microvilli of epithelial cells in the small intestine Ascorbate is a drug used in the treatment of type 2 diabetes. Molecules of ascorbic have a very similar shape to that of the substrate for maltase. (1) Explain how ascorbase acts to inhibit these membrane-bound enzymes.

Answers

Answer: Ascorbase a form of ascorbate, a drug used in the treatment of type 2 diabetes which acts to inhibit maltase a membrane bound enzyme that completes the digestion of starch in the human body.this inhibition is done through;

- By preventing substrates from binding to the active site therefore forming few enzyme complex substrates.

- it also inhibits the enzymes by binding to the active sites of that enzyme.

- it also does so by reacting slowly and also because it has a complementary shape to the active site of the enzyme maltase.

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

Examine the statement. A scientific theory can become a scientific law, but a scientific law cannot become a scientific theory. If the statement is true, select “True.” If it is false, select the option that is true 1.) True 2.) A scientific theory can become a scientific law, and a scientific law can become a scientific theory. 3.) A scientific law can become a scientific theory, but a scientific theory cannot become a scientific law. 4.) A scientific theory cannot become a scientific law, and a scientific law cannot become a scientific theory.

Answers

Answer:

It's true.

Explanation:

In general, a scientific law is the description of an observed phenomenon. It doesn't explain why the phenomenon exists or what causes it. The explanation of a phenomenon is called a scientific theory. It is a misconception that theories turn into laws with enough research.

When the scientists test the idea, they develop a theory by following a set of logical steps. A theory becomes a scientific law once it has been rigorously examined and accepted. Thus, option A is correct.

What A scientific theory can become a scientific law?

One prevalent fallacy is the idea that hypotheses eventually become laws. Despite the number of supporting examples, hypotheses do not actually become laws after repeated testing.

Scientific laws, like theories, explain occurrences that the scientific community has determined to be verifiably true. In general, laws explain what will occur in a specific circumstance and are proven by a mathematical equation, whereas theories explain how the phenomenon occurs.

Therefore, A testable explanation of a natural event is what constitutes a scientific hypothesis. The concept of gravity, for instance, explains why an apple always falls to the ground when.

Learn more about scientific theory here:

https://brainly.com/question/2375277

#SPJ2

Which type of chromosomal disorders seems to have the greatest affect on a person’s health—disorders involving autosomes or sex chromosomes? Why do you think this might be the case? thanks in advance

Answers

Answer:

Disorders involving sex chromosomes.

we can take Turner's syndrome n klinefelter's syndrome as examples.

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

6. Which type of seismic wave is highlighted in the image?
O A. P wave
B. S wave
O C. Love wave
D. Rayleigh wave

Answers

Answer:

Rayleigh wave

Explanation:

Rayleigh waves are a type of surface acoustic wave that travel along the surface of solids. They can be produced in materials in many ways, such as by a localized impact or by piezo-electric transduction, and are frequently used in non-destructive testing for detecting defects.

hope it helps :)

please mark it the brainliest!

Rayleigh wave, surface acoustic waves called Rayleigh waves move along the surface of solids, hence option D is correct.

What is seismic wave?

They are commonly employed in non-destructive testing to find flaws and can be created in materials in a variety of methods, as by a localized impact or by piezoelectric transduction.

These include what are known as Rayleigh waves. A Rayleigh wave's amplitude decreases with depth below the surface and becomes noticeably tiny at depths greater than a few wavelengths.

As a result, the disturbance is limited to a solid's surface layers. The motion experienced by the surface layers includes both transverse and longitudinal components.

Therefore, Rayleigh wave type of seismic wave is highlighted in the image.

Learn more about seismic wave, here:

https://brainly.com/question/12651581

#SPJ5

The removal of waste products from the body is called

Answers

Answer:

It is called EXCRETION.

Explanation:

This is a process by which metabolic waste is removed from a living organism.

The excretory organs removes these waste.

Accumulation of these in the body is very harmful to our system.

Hope all these helps.

Los cuyes del pelo crespo, al ser cruzados con cuyes de pelo liso, producen solamente cuyes de pelo crespo, si se cruza uno de los cuyes de pelo crespo de F1 con el homocigoto recesivo. ¿Qué proporciones es posible esperar

Answers

Answer and Explanation:

Datos:

El alelo dominante del gen que codifica para el tipo de pelo, determina el pelo crespo. Llamemos P al alelo dominante. Genotipos que expresan pelo crespo: PP (Homocigota dominante) y Pp (Heterocigota)El alelo recesivo del gen que codifica para el tipo de pelo determina el pelo liso. p es el alelo recesivo.Genotipo homocigota recesivo, pp, expresa pelo liso.La cruza entre un cuy de pelo crespo y un cuy de pelo liso producen solo cuyes de pelo crespo. Esto implica que el parental con pelo crespo era homocigota dominante.

1º Cruza: un cuy de pelo crespo y un cuy de pelo liso

Parental)  PP    x    pp

Gametas) P   P      p   p

Cuadro de Punnet)      P          P

                             p     Pp       Pp

                             p     Pp       Pp

F1) 100 % de la progenie posee pelo crespo

     4/4 tienen genotipo heterocigoto.

2º Cruza: un cuy heterocigoto de la F1 y un cuy homocigoto recesivo

Parental)   Pp      x       pp

Gametas) P    p        p     p

Cuadro de Punnet)     P         p

                          p    Pp        pp

                          p    Pp        pp

F2)   50% de la progenie tiene pelo crespo

       50% de la progenie tiene pelo liso

       2/4=1/2 de la progenie es heterocigota

       2/4 = 1/2 de la progenie es homocigota recesiva.

Which type of volcanic mountain has wide, gentle slopes?

Answers

Answer:

Shield volcanoes

Explanation:

Answer:

Shield volcanoes

Explanation:

Shield volcanoes erupt thin, 'runny', lava that forms a gently sloping structure. Where a volcano produces low viscosity, runny, lava it spreads far from the source forming a volcano with gentle slopes. This type is called a shield volcano. Mauna Kea and Mauna Loa are shield volcanoes.

all members of the plant kingdom contains chlorophyll? true or false

Answers

Answer:

this is true

Explanation:

if it isnt in the leaves of a plant, then its in the stem, or maybe, the entire thing is green!

flowers have green stems, trees have green leaves, lily pads are green, etc.

hope this helped

Answer:

True

Explanation:

All plants contain chloryphyll

Identify the error in the following statement: “Photosynthesis is a chemical
reaction that takes place in the chloroplasts of green plant cells, where chemical
energy is used to convert carbon dioxide and water into glucose and oxygen."
A. No errors
B. "water" and "oxygen" should be switched
C. "chemical" should be "light"
D. "chloroplasts" should be "mitochondria"

Answers

Answer:

It is 'C'

Explanation:

The chemical reaction that occurs in the chloroplast is:

6CO₂ + 6H₂O → C6H₁₂O₆ + 6O₂

The electromagnetic energy of sunlight is converted to chemical energy in the chlorophyll-containing cells of photosynthetic organisms. The granum stores the photon particles from light and converts its energy into chemical energy to convert carbon and water into glucose and oxygen.

Answer:

c

Explanation:

Which describes a grizzly bear’s habitat? all the biotic factors in the ecosystem all the abiotic factors in the ecosystem the role of the bear in the ecosystem the physical area where the bear lives

Answers

Answer:

it is D

Explanation:

A grizzly bear’s habitat comprises of the physical area where the bear lives

What is a habitat?

A habitat is defined as the dwelling home of living organisms.

There are three major types of habitat; namely:

Terrestrial habitatAquatic habitatArboreal habitat

Terrestrial habitat is the land habitatAquatic habitat is the water habitatArboreal habitat is the tree habitat

Learn more about habitat:

https://brainly.com/question/25832580

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything

Answers

The question is incomplete,below is the complete question.

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything?"

You tell the Clinical Nurse Specialist (CNS). As the two of you move him into the bed, you notice that his chest tube bottle is lying on its side on the gurney, with air going into it. When you point this out to the CNS, she immediately grabs the bottle and sets it upright on the floor. You see air start bubbling through the fluid right away. "That was the problem!" she says. "They lost the water seal, and air was going into his chest from the bottle. You would not believe how many times that happens on transport." When you examine Mr. B, you have trouble detecting his lung sounds on the left. Even stranger, his apical heart sound is in the wrong place - it is over toward the right side of his chest. His respiration rate and heart rate are both increased, and he is struggling to breathe. "Let's give him a little oxygen. He'll be a lot better in a half-hour," says the CNS. "Check back on him."

QUESTION - Why would accumulation of air in his pleural space cause his heart sounds to be in the wrong place?

Accumulation of air in Mr B pleural space will cause his heart sound to be heard in the wrong place because the left side is his chest is being filled up with air making the organs in his chest to to be pushed over to the right side.

What will happen if external factors affect cell division in a group of cells placed in a culture dish? A) Anchorage dependence will cause the cells to attach to each other after dividing. B) Anchorage dependence will prevent the cells from dividing until they attach to the dish. C) Density-dependent inhibition will cause the cells to divide until the dish is completely full. D) Density-dependent inhibition will destroy large cells to create room for new cells.

Answers

Answer:

C) density-dependent inhibition will cause the cells to divide until the dish is completely full

Explanation:

Just took the exam

If Earth’s average surface temperature continues to change over the next 30 years at the same rate it changed between 1980 and 2010, the average temperature will most likely be around

Answers

Answer:

Its B....

Explanation:

Get that 100.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

What is conjunctivitis

Answers

Answer:

[tex] \underline{ \underline \orange{see \: below}}[/tex]

Explanation:

Conjunctivitis is an inflammation, infection of the conjunctiva. It is the most common ocular disease worldwide.It is characterized by a pink appearance because of subconjuctival blood vessels hemorrhage.

Simply, we can define it as :

Conjunctivitis ( pink eye ) is an inflammation or infection of the transparent membrane ( conjunctiva ) that lines your eyelid and covers the white part of your eyeball.

Pink eye is commonly caused by a bacterial or viral infection , an allergic reaction or in babies.

The most common pink eye symptoms include:

Redness in one or both eyesItchiness in one or both eyesA gritty feeling in one or both eyes

Hope I helped !

Best regards!

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

On May 18, 1980, Mount St. Helens in Washington State experienced a huge volcanic eruption after a magnitude 5.1 earthquake. During the eruption, hot ash and pumice poured down the west, south, and east sides of the mountain, melting the snow and ice at the top of the volcano and producing volcanic mudflows. Which type of process first occurred in the ecosystem around Mount St. Helens after it erupted?
primary succession
secondary succession
a climax community
species extinction

Answers

Answer:

Primary succession

Explanation:

Primary succession is mostly cause by volcanic eruption

The first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

What is a primary succession?

The term primary succession refers to the organisms that first occur in an ecosystem after a major event such as the volcanic eruption has taken place.

In this case, the first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

Learn more about primary succession: https://brainly.com/question/26675203

Why might an ecosystem be better able to
cope with a season of forest tent caterpillar
outbreak than an increase in acidic
precipitation?

Answers

Answer: It contains leach aluminium.

Explanation:The ecological effect of acid rain are most Clearly seen in aquatic environment such as, stream, lakes and marshe where it can be harmful to fish and other wildlifes.

Other Questions
A 635 mL NaCl solution is diluted to a volume of 1.13 L and a concentration of 5.00 M . What was the initial concentration C1? A modified DCF analysis is best for evaluating and selecting the optimal strategic alternative when a company has ___ goal(s) and ___ measure(s). Factor 4x^2-22x+30. A person may legally ride in the back of a pickup truck when: The sides of the pickup bed are at least 24 inches high. The back of the pickup is covered with a camper shell. In a secured seat and while using an approved safety belt. the top of a square table is144 squared metres.what is the size of the table Which of the following is NOT a factor of sustainability?Group of answer choiceseconomicsethicsbiodiversitynatural capitalsolar energy The direct labor budget of Yuvwell Corporation for the upcoming fiscal year contains the following details concerning budgeted direct labor-hours: 1st Quarter 2nd Quarter 3rd Quarter 4th Quarter Budgeted direct labor-hours 11,000 9,700 10,000 10,800 The company uses direct labor-hours as its overhead allocation base. The variable portion of its predetermined manufacturing overhead rate is $5.75 per direct labor-hour and its total fixed manufacturing overhead is $78,000 per quarter. The only noncash item included in fixed manufacturing overhead is depreciation, which is $19,500 per quarter. Required: a. Prepare the companys manufacturing overhead budget for the upcoming fiscal year. b. Compute the companys predetermined overhead rate (including both variable and fixed manufacturing overhead) for the upcoming fiscal year. Q2Mirrors on the walls give the room the ______ of being much bigger than it really is. Illusion allusion What transportation mode has very high initial investment costs but gives a very low cost per mile for products that are highly specialized and require no packaging? Cafeteria Meals I regularly purchase my lunch in the cafeteria; however, we only have one meal option each day. I would not serve some of the meals prepared in our cafeteria to cockroaches. Consider the school's pepperoni pizza. I am one who rarely turns down pizza, especially if it has pepperoni on it, but the pizza that our school serves is just too greasy. I even put paper napkins over the pizza in order to soak up the grease. Nevertheless, I always have a stomachache in the afternoon on pizza day. Some of my friends do not even eat lunch on pizza day because the pizza our school serves makes them feel ill too. If we had more meal options at lunch, we could choose foods that left us feeling better in the afternoons. 18 Select the correct answer. What is the best thesis statement for this argument? A. Some of our students are not allowed to eat certain foods and must skip lunch. B. Many schools in nearby districts offer a variety of meal options to their students. C. Schools should not be allowed to sell high-fat desserts to students. D. Our school needs to offer several selections for food at what would be the answer for f(0) = -3x+7? An electric field from a charge has a magnitude of 4.5 x 10^4 N/C at a certainlocation that points outward. If another charge with a magnitude of -2.0 x 10^-6 Cis brought near it, what is the strength of the electrostatic force that acts on thischarge and how do the two charges behave?0.09 N; repel each other-0.09 N; attract each other-2.3 N; repel each other2.3 N; attract each other Reflections, rotations, and translations are types of transformations. A reflection flips an image, a rotation spins an image, and a translation slides an image. Draw a shape on a piece of paper and cut it out. Then, flip it, spin it, and slide it. Explain how each transformation affects the size and shape of the image you drew. IDK how to answer this PLS HELP Read the excerpt from the preamble to the Constitution. Insure domestic Tranquility, provide for the common defence, promote the general Welfare. According to the excerpt, the responsibility of government is to please help me answer these in variable and constant terms 7s + 8s - 6h Read the article. Use your understanding to answer the questions that follow. What type of source is this article? primary or secondary and how do you know Let surface S be the boundary of the solid object enclosed by x^2+z^2=4, x+y=6, x=0, y=0, and z=0. and, let f(x,y,z)=(3x)i+(x+y+2z)j + (3z)k be a vector field (for example, the velocityfaild of a fluid flow). the solid object has five sides, S1:bottom(xy-plane), S2:left side(xz-plane), S3 rear side(yz-plane), S4:right side, and S5:cylindrical roof. a. Sketch the solid object. b. Evaluate the flux of F through each side of the object (S1,S2,S3,S4,S5). c. Find the total flux through surface S. As part of a chemistry experiment, Barry is making a mixture of two solutions. He uses 4 cups of solution A for every 2 cups of solution B. The table below shows the numbers of cups he uses of solution A and solution B. Solution A (cups) Solution B (cups) 4 2 8 4 12 6 16 8 Using the information from the table, choose the correct statement. A. The ratio of the number of cups of solution A to the total number of cups of the mixture is 2:3. B. The ratio of the number of cups of solution A to the total number of cups of the mixture is 3:2. C. There are 3 cups of solution A for every 6 cups of mixture. D. For each cup of solution A, there are 2 cups of solution B. A soccer team has 18 players. 5 of the players have scored at least 4 goals this season. Approximately what percent of the players have scoredat least 4 goals?Select the best answer from the choices provided.O A. 1596OB.30%.6096D7596 Find the square root of 25 6 4 5 7