What needs to be known about an object in order to determine its kinetic energy.


P.S Please help I need to answer this question for my pendulum experiment.

Answers

Answer 1

Answer:

we need to know it's

mass and velocity

Explanation:

then use the formula of kinetic energy

Answer 2

Answer:

Mass and velocity (or motion).

Explanation:

KE=(1/2)mv^2.

The kinetic energy of an object is the amount of work (expended energy) that's required to move (or more accurately, to accelerate) the object to a specific velocity.  So, if you know the mass of the object, and you know it's current velocity, you can determine it's kinetic energy with the formula above.


Related Questions

What can be concluded from the statements above?
A. A harmful compound can become harmless when its elements are separated.
B. A harmless compound can become harmful when its elements are separated.
C. Breaking a compound into its separate elements has no noticeable effects.
D.Breaking a compound into its separate elements can create carbon dioxide.

Answers

Answer:

B

Explanation:

I am not sure why

Answer:

Yea I think B as well!!!!!

Question
What is the best thing to do if you are asked to complete a task at work that you
believe could endanger your safety?
A) ask someone else to do it
B) keep working, but talk to your boss when they are available
C)tell your boss and return to the task only when you feel it's safe
D) trust your boss and complete the task

Answers

C — all others endanger you.
it’s C the other person is correct

The best description of the Big Bang Theory is ______________
A. The universe began with cold dense energy compressing into matter after which all matter and energy began rapidly contracting toward each other.

B. The universe began with hot dense energy compressing into matter after which all matter and energy began rapidly expanding away from each other.

C. The universe began with hot dense matter after which all energy began rapidly expanding away from each other.

D. The universe began with cold, spread out matter compressing into energy, after which all matter and energy began slowly moving toward each other

Answers

The answer is the letter “c”

Answer:

B. the universe began with hot dense energy compressing into matter after which all matter and energy began to rapidly expanding away from each other.

hope it helps

. A skydiver jumps from an airplane and opens his parachute. At some point during his fall, the downward force of gravity on the skydiver is equal to the upward force of drag on the parachute. Which of the following best describes the skydiver's motion at this point? The skydiver is gaining speed downward. The skydiver is moving at a constant speed. The skydiver is decreasing in speed.

Answers

Best to describe the skydiver’s motion is moving at a constant speed.

The upward drag and downward force is equal for the skydiver when he jumps down from the plane. Thus, he experiences a constant speed through out his motion.

What is gravitational force?

Gravitational force is a kind of force by which a body attracts other objects into its center of mass. Force exerted by the body depends on the mass and distance to it.

Earth pull every objects into its surface by gravitational fore of attraction. For moving body the the gravitational force acting downward have an acceleration due to gravity.

The skydiver experiences a force upward by the drag of a the parachute. When this force becomes equal to the downward fore of gravity, then his speed will be constant thus, no gain or lose for speed.

To find more on gravitational force, refer here:

https://brainly.com/question/12528243

#SPJ2

The photo shows wires made of pure copper, an element
What would the smallest piece of copper be?
A. Copper atom
B. Mixture of different kinds of metallic elements
C. Copper molecule
D. Compound containing two or more elements

Answers

Answer:

B

Explanation:

I hope its right. I'm pretty sure.

Answer:

Explanation:

Copper Atom

All of the following rivers are labeled on the map above except the __________ River.
A. Danube
B. Volga
C. Lena
D. Ob

Answers

The answer for this problem would be c
The answer would be C

Can you help me balance the following chemical equation?!
Al(OH)3 + H2CO3 = Al2(CO3)3 + H2O

Answers

Answer: [tex]2Al(OH)_3+3H_2CO_3\rightarrow Al_2(CO_3)_3+6H_2O[/tex]

Explanation:

According to the law of conservation of mass, mass can neither be created nor be destroyed. Thus the mass of products has to be equal to the mass of reactants.

The number of atoms of each element has to be same on reactant and product side. Thus chemical equations are balanced.

The balanced chemical equation will be :

[tex]2Al(OH)_3+3H_2CO_3\rightarrow Al_2(CO_3)_3+6H_2O[/tex]

What is the mass of a 270 cm3 sample of a metal with density of 3.66 g/cm3?

Answers

Answer:

988.2 g

Explanation:

The mass of a substance when given the density and volume can be found by using the formula

mass = Density × volume

From the question we have

mass = 3.66 × 270

We have the final answer as

988.2 g

Hope this helps you

electron configuration for Li

Answers

Answer:

the electronic configuration of Li is

=》 2, 1

and in spdf configuration it's 1s^2 2s^1

Answer: [He] 2s1

Explanation:

Electrons per shell: 2,1

Atomic number: 3

Electronegativity: 0.98

Atomic mass: 6.941 u

Discoverer: Johan August Arfwedson

Period: Period 2 element

Metals tend to — electrons and nonmetals tend to —
Electrons

Answers

Answer:

Non-metals tend to gain electrons to attain Noble Gas configurations. The have relatively high Electron affinities and high Ionization energies. Metals tend to lose electrons and non-metals tend to gain electrons, so in reactions involving these two groups, there is electron transfer from the metal to the non-metal.

The power has gone out and you find a flashlight that uses batteries. When you turn on the flashlight, you are transforming:

Answers

In a flashlight, the electrical energy becomes light energy and thermal energy in the bulb.
The electric energy

What is true about a chemical reaction

Answers

Answer: energy is transferred, but it can go to the products or the reactants.

Explanation: in a chemical reaction, the atoms and molecules that interact with each other are called reactants.

A chemical equation summarizes a reaction. ... All the atoms present at the start of a reaction are present at the end. true.

48g of magnesium reacts with four moles of sulfuric acid. determine which reactant is the limiting reactant

Answers

Answer:

Magnesium is limiting reactant.

Explanation:

Based on the reaction:

Mg + H₂SO₄ → MgSO₄ + H₂

1 mole of Mg reacts per mole of sulfuric acid

To find limiting reactant we need to convert mass of magnesium to moles. If moles of Mg > moles sulfuric acid, sulfuric acid is limiting reactant and vice versa.

Moles Mg -Molar mass: 24g/mol-:

48g Mg * (1mol / 24g) = 2moles

As there are just 2 moles of Magnesium, just 2 moles of H₂SO₄ will react and 3 moles will remain. That means:

Magnesium is limiting reactant.

What is chemical structure about?

Answers

Answer:

chemical structure determines the molecular geometry of ca compound by prtraying the arrangement of atoms and chemical bonds in the molecule..

Explanation:

hope this helps any <3

Use the equation weight=mg to find the weight of a 45 kg child

Answers

Answer:

well the answer is 99.2lbs I know that

Which of the following reagents can be used to distinguish between sodium sulphite and sodium sulphate?
(1) iron(II) chloride solution
(2) acidified potassium permanganate solution
(3) concentrated nitric acid
A. (1) only
B. (2) only
C. (1) and (3) only
D. (2) and (3) only

please please help this confused me for so long​

Answers

The answer is A si yeah

can someone pls help me im tryna get this done tysm brailiest for free

Answers

Answer:

geothite

Explanation:

i did a test on this a few months ago

Answer:

sphalerite i think

Explanation:

Help with chemistry please

Which chemical reaction involves the most oxygen atoms?

Answers

H2O is A chemical reaction of the most oxygen atoms

Lab: Ionic and Covalent Bonds

Answers

Answer:

see image

Explanation:

Answer:

hope this helps

Explanation:

Significant Figures
1. Indicate how many significant figures there are in cach of the following measured values.
un
246.32
5
1.008
700000
107.854
3
0.00340
3
350.670
4
100.3
14.600
1.0000
6
0.678
0.0001
320001

Answers

I think answer should be the first one please give me brainlest I hope this helps let me know if it’s correct I

Which is the balanced version of the half-reaction below?

Answers

Answer:

The answer is B

Explanation:

Because H2S →S + 2Hplus

Answer this please if you do i will give you brainilset if you get it correct

Answers

Answer:

D

Explanation:

parts of Earth and its atmosphere where there is life

Answers

Answer:

stratosphere

Explanation:

The stratosphere is crucial to life on Earth because it contains small amounts of ozone, a form of oxygen that prevents harmful UV rays from reaching Earth.

s. What happens
the heat
from
the heat source?

Answers

Radiation happens when heat move as energy wave called infrared wave directly from its source to something else .
well what happens is radiation happens when heat moves as energy waves, called infrared waves, directly from its source to something else. this is how the heat from the sun gets to earth. in fact, all hot things radiate heat to cooler things. when the heat waves hits the cooler thing,they make the molecule of the cooler object speed up. hopefully this is the correct answer

(sand) and (Sand with water) both of them are heterogeneous
mixture isn't it?​

Answers

Answer:

yes true

Explanation:

both are heterogeneous

The term "alchemy" refers to early pseudoscientific attempts to transform common
elements into more valuable elements (such as lead into gold), For one kind of atom to
become another kind of atom, which particle(s) of the atom need to be expelled or gained?
Proton
Electron
Neutron
Quantum Particles

Answers

Answer: The correct answer is option B. electron.

Explanation:

There are 3 subatomic particles:

Electrons: They carry negative charge and are present in orbits around the nucleus of an atom.Protons: They carry positive charge and are present inside the nucleus of an atomNeutrons: They does not carry any charge and are present inside the nucleus of an atom.

An atom forms an ion, when it looses or gains an electron.

When an atom looses electron, it form a positive ion known as cation.When an atom gains electron, it form a negative ion known as anion.

Hence, the correct answer is option B. electron.

The particle(s) of the atom that is needed to be expelled or gained in an alchemy process which involves transformation of one element into  valuable elements or atom to another is B:Electron.

Alchemy can be regarded as branch of  philosophical and protoscientific tradition that is traceable to China,  and Europe. In the process of transformation of one element to another useful element or compounds , there is usually transfer of electron.

Electronegative element like chlorine usually gain electron and are anion, while electropositive elements like potassium will loose electron( cation) all involves the transfer of electron.

Therefore, option B is correct.

Learn more at:

https://brainly.com/question/1255220?referrer=searchResults

Where in the ATOM are the protons and neutrons found?
I

Answers

Answer:

in nucleus atom of proton and netwon found

Marissa uses her bicycle to do a morning paper route. Starting at her home, she travels 3 km North, then 1 km East, then 3 km North, and lastly 1 km West. She completes the root in 1.5 hours. a. What is your displacement in regards to her home?
b. What is her velocity?

Answers

a. displacement = 6 km

b. velocity = 4 km/h

Further explanation

Given

a morning paper route

Required

displacement

velocity

Solution

Displacement is a vector quantity that shows changes in the position of objects in a certain interval of time. Displacement has magnitude and direction

Can be simplified displacement = distanced traveled from starting point to ending point

a. Since we only consider the starting point and the end point, we just need to add up the distances to the north

3 km + 3 km = 6 km

b. Velocity = displacement changes with time

[tex]\tt v=\dfrac{d}{t}=\dfrac{6~km}{1.5}=4~km/h[/tex]

Write an informal definition of half-life.

Answers

the time required for the activity of a substance taken into the body to lose one half its initial effectiveness. Informal. a brief period during which something flourishes before dying out.

hope this helps ^^

what is the temperature in the fahrenheit?

Answers

A or c but I think it’s a.
The correct answer would be a
Other Questions
can you please help me:) Change the following sentence into passive form1. What question did they raise in the discussion?2. They are going to build that bridge in 20183. They used to build houses of wood 4. How many trees can we save for every ton of recycled newsprint ?5. We can make many things from wood 6. If I were you. I wouldnt accept his invitation 7. They must do it before I come 8. Where do they keep a large collection of books?9. They can find the books they want in the library 10. What do they keep a large collection of the books for ?Thank you very much What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC What is the main purpose of foreign aid? Describe the religions of the early Indigenous peoples. Only________ can declare war! which sea would a boat pass through traveling from South Korea to Japan RIP grandsonhow does earths crust change earths surface According to the map, Italy in the early 19th century was under the control of Austria. under the control of Spain. united as the Kingdom of Italy. split into kingdoms and city-states. [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! Name the factors in each of the following problems i need help lol i forgot how to do this Q.Ankit said to Rita, " It is your last chance." 1.Ankit said Rita it is your last chance. 2.Ankit told Rita that it is her last chance. 3.Ankit told Rita that it was her last chance. 4.Ankit told Rita that it was their last chance. what is the circumference of this circle? (Use C = [tex]\pi[/tex]d; [tex]\pi[/tex] = 3.14.)giving 20 points to the person who answers! no need to show your work, thank you.