what stopped the romans first attempt to invade britain?

Answers

Answer 1

Answer:

the romans lost

Explanation:


Related Questions

PLEASSSE HELP MAKING BRAINLIEST IF RIGHT

Answers

Answer:

A

Explanation:

Go with the answer A

A the answer is a it won’t let me send it without 20 characters

This form of government has those powers only given to it by the people

Answers

Answer:

That's Democracy

Democracy

Hope this helps :)

What is the olest phone ever

Answers

Answer:

A flip phone

Explanation:

Answer:

the oldest phone doesn't really have a name but the oldest mobile phone ever is called the 1989 – MOTOROLA MICROTAC 9800X

Which of the following had the best relationship with the Indians?

France


England


Spain

Answers

Answer:

Spain .         brainliest?

Explanation:

Spanish leaders formed alliances with some of the Indian tribes and provided them with tools, crops, livestock, and arms. The new materials available to these tribes gave them superior weaponry over their enemies. As Indians acquired horses, they became more mobile.

I think it was France. Hope it helps:)

Why might this question trouble the nation for centuries

Answers

Answer:

ggggggggggg

Explanation:

. What is the latitude and longitude of Colombo, Sri Lanka?

Answers

Answer:

6.9271° N, 79.8612° E

Which is a solution to the deforestation problem in the Amazon
Rainforest? *
O
Cleaner burning fuels
strict emissions on cars
have large protected areas of land in the forest
O
public transportation

Answers

Answer:

Cleaner burning fuels

was the american revolution conservative or radical

Answers

it was a conservative movement intended to preserve the existing social, political, and economic power.

I NEED HELP ASAP. WILL GIVE BRAINLIEST!!!

Research and describe European contact with Ming China.

Answers

Answer:

Explanation:

Given textual and archaeological evidence, it is thought that thousands of Europeans lived in Imperial China during the period of Mongol rule.[1] These were people from countries traditionally belonging to the lands of Christendom during the High to Late Middle Ages who visited, traded, performed Christian missionary work, or lived in China. This occurred primarily during the second half of the 13th century and the first half of the 14th century, coinciding with the rule of the Mongol Empire, which ruled over a large part of Eurasia and connected Europe with their Chinese dominion of the Yuan dynasty (1271–1368).[2] Whereas the Byzantine Empire centered in Greece and Anatolia maintained rare incidences of correspondence with the Tang, Song and Ming dynasties of China, the Roman papacy sent several missionaries and embassies to the early Mongol Empire as well as to Khanbaliq (modern Beijing), the capital of the Mongol-led Yuan Dynasty. These contacts with the West were preceded by rare interactions between the Han-period Chinese and Hellenistic Greeks and Romans.

Identify one change you see from the previous map

Answers

Answer:

There are lots of new land being discovered in Africa in about 29 years.

Just compare the maps

Please helppppppppppppppppppppp

Answers

Answer:

salt and gold is ur answer

Answer: Gold and Salt

Explanation:

Salt and good were their main goods.

Help please In what modern countries did the Inca civilization exists?

Answers

Answer:

Túpac Inca's empire then stretched north into modern-day Ecuador and Colombia. Túpac Inca's son Huayna Cápac added a small portion of land to the north in modern-day Ecuador. At its height, the Inca Empire included Peru, western and south central Bolivia, southwest Ecuador and a large portion of what is today Chile, north of the Maule River.

Explanation:

Have A Wonderful Day !!

Answer: Peru

Explanation:

Which of the following statements best defines the domino theory?

A. communism will topple the global economy
B. if one country falls to communism, others in the region will fall, too.
C. Socialist governments are a threat to freedom
D. communism will cause the fall of the US

Answers

Answer:

b

:]

have a good day

The domino theory defines if one country falls to communism, others in the region will fall, too. The correct option is B.

What is the importance of the domino theory?

Finally, the domino theory was significant because it explained American foreign policy at the time, during which the country was involved in two major wars. Furthermore, in both wars, the United States struggled and thousands of American soldiers were killed.

The domino theory held that all Soviets, communists, and socialists were inherently evil. A nuclear strike by the United States on Vietnam was required to prevent a Viet Cong victory that would set off a chain reaction of countries falling to the communists, similar to a row of falling dominoes.

Thus, the ideal selection is option B.

Learn more about the domino theory here:

https://brainly.com/question/28082356

#SPJ6

Use this map to answer the following question:

A map shows the African Kingdoms and Trading States. Red lines on the map show trading routes in Africa. The map shows Mali, Ghana, and Songhai in northwestern Africa. In northwestern Africa, the map shows Mali, with no active trade routes, along with Ghana and Songhai which each have numerous routes leading outward. Kumbi Saleh is a city in Ghana along a red line leading north toward Morocco and the Mediterranean Sea and east toward Songhai and other African kingdoms and states. Songhai is located to the east of Mali. Timbuktu and Gao are cities in Songhai that are located along a red line to the north, west, and south.
© 2012 The Exploration Company

Which of the following describes the ancient empire of Ghana? (5 points)


Isolated from other empires

Neutral in other groups’ conflicts

Dependent on distant empires

Active in trade with others

Answers

Answer:

Active in trade with others

Explanation: got it right on a test

1. Where was Marcus Garvey born?:
a. Great Barrington, Massachusetts
b. St. Ann's Bay, Jamaica
C. Chicago, Illinois
d. Kingsford Plantation, Bahamas

Answers

Answer:

Of Course! "B.St.Ann's Bay,Jamaica

"

Explanation:

Risk*

Answer:

b

Explanation:

Marcus Mosiah Garvey Jr. ONH (17 August 1887 – 10 June 1940) was a Jamaican political activist, publisher, journalist, entrepreneur, and orator. He was the founder and first President-General of the Universal Negro Improvement Association and African Communities League (UNIA-ACL, commonly known as UNIA), through which he declared himself Provisional President of Africa. Ideologically a black nationalist and Pan-Africanist, his ideas came to be known as Garveyism.

hey um i need help with this project its about the 3 kingdoms of egypt​

Answers

Answer:

The history of ancient Egypt is divided into three main periods: the Old Kingdom (about 2,700-2,200 B.C.E.), the Middle Kingdom (2,050-1,800 B.C.E.), and the New Kingdom (about 1,550-1,100 B.C.E.). The New Kingdom was followed by a period called the Late New Kingdom, which lasted to about 343 B.C.E.     PLS THANK ME AND VOTE ME AND BRAINLIEST ME

Explanation:

Please help me I don’t know this

Answers

Answer:

2: we the people

Explanation

the words we the people mean rule by the people

Why hadn't conquistadors conquered Africa during the age of exploration?

Answers

Answer:

Because they didnt have drugs to fight malaria

Explanation:

Malaria was a big deal and very big in Africa too.

did the u.s pursue the policy of isolation during the cold war​

Answers

Containment was a United States policy using numerous strategies to prevent the spread of communism abroad. A component of the Cold War, this policy was a response to a series of moves by the Soviet Union to enlarge its communist sphere of influence in Eastern Europe, China, Korea, and Vietnam.

Please Help
When Britain agreed to let the 49th parallel be US/British boundary, what other state boundary was being debated with Britain?
a.
Maine
c.
California
b.
New Mexico
d.
Alaska

Answers

Maine. Maine is near the northeast corner of the US and borders Canada.

Answer:

Mainnnnnnne weeeeeeeeeeeeeeeeeeeeeeeeeeee

Explanation:

This graph shows the number of shipwrecks in the Mediterranean Sea from 150 BC to AD 350. Which conclusion can be drawn from the data?
200
180
160
140
120
Number of Shipwrecks
100
80
60
40
20
0
150 BC
50 BC
AD 50
AD 150
AD 250
AD 350
ОА.
After 50 BC, people developed better navigation and shipbuilding methods to protect their ships.
OB.
The region witnessed the Dark Ages, so there was no information about shipwrecks after 200 BC.
O C.
More shipwrecks occurred after 200 BC due to frequent wars in the region.
OD. People stopped using the Mediterranean Sea for trade after AD 50, which reduced the number of shipwrecks.
O E.
The data does not show any definite trend in shipwrecks in the Mediterranean from AD 50 AD to AD 350.

Answers

Answer:

ОА.

After 50 BC, people developed better navigation and shipbuilding methods to protect their ships.

Explanation:

After 50 BC, people developed better navigation and shipbuilding methods to protect their ships conclusion can be drawn from the data. Thus, option A is correct.

What are a shipwreck?

The debris of a ship that has either been stranded on land or submerged to the bottom of a body on the water is called a shipwreck. Both planned and accidental shipwrecking are possible.

Once the crew of the ship permitted the ship to run into rocks, corals, glaciers, or other ships, many catastrophes have happened. One of the main reasons of shipwrecks has already been a collision. The rainy season makes accurate steering more challenging due to reduced sight.

The quantity of shipwrecks there in the Mediterranean Sea period 150 BC to AD 350 is depicted in this graph. To preserve their ships, mankind improved building and navigating techniques after 50 BC.

Therefore, option A is the correct option.

Learn more about shipwrecks, here:

https://brainly.com/question/24565210

#SPJ5

Please help me!! :)

Answers

Answer:

1= 4th

2= 3rd

3= 1st

4= 5th

5= 1st

Explanation:

I Took The Quiz And Got This Correct.

Can someone please help me with this I’ll give them extra points and brilliant it actually has to be an answer though

Answers

Answer:

im pretty sure its main idea

Explanation:

Answer:

Main idea

Explanation:

What is this “check” that Dr. King refers to? How has America defaulted on this check?

Answers

Answer:

dr.'s “Dream” speech used ... “In a sense we've come to our nation's capital to cash a check,” he said, ... “It is obvious today that America has defaulted on this promissory note ...

Explanation:

What did Americans think Britain was doing with Native Americans?

Answers

The War of 1812 created a lasting impact on several tribes whose communities were involved. For Native Americans, the War of 1812 created Indian heroes, established historic places, and dispossessed ancient home areas.

Answer:

Conflicts between U.S. citizens and Native Americans were frequent in the years before the war and many in the United States blamed Great Britain and its colonies for helping to arm the Native Americans. Indeed, for British North America, maintaining positive relationships with Native Americans in the porous borderlands was a sensible means of guarding against incursions by the much more populous United States. Those in the United States who were eager to strip natives of their land were more likely to frame the situation as one of British aggression.  It is too much to say that territorial desires had a significant role in sparking the War of 1812, but the opportunities for national expansion were an important side issue of the conflict.

Territorial ambitions were not focused solely on lands held by Native Americans. Some American politicians felt that the conquest of Canada would complete the business of the American Revolution, and residents of British North America had been nervous for years with their southern neighbor’s growing size and power. Similarly, some in the south saw a war as one means to move in on Spanish Florida and its native allies.

In the years before the War of 1812, many Native Americans were joining the growing Pan-Indian movement. Led by Tenskwatawa, a spiritual leader also known as the Prophet, and his brother Tecumseh, the movement’s political and military head, the Pan-Indian movement sought political coordination between groups to combat the deceptive land agreements that whites struck with random tribal members.

The Battle of Tippecanoe, fought on November 7, 1811, is often viewed as a prelude to the War of 1812. Governor of the Indiana Territory William Henry Harrison marched 1,000 regulars and volunteer militia toward the native village known as Prophet’s Town with the intent to destroy it and deprive Native Americans of a suspected base of operations. Native Americans met the force and suggested a parley. Harrison’s forces camped some way outside the town. Native forces attacked at night, killing nearly two hundred soldiers, but Harrison’s forces rebounded and with their greater numbers dispersed the attackers and proceeded to advance and burn Prophet’s Town.  The battle further damaged Anglo-American relations, as Britain was castigated for supplying weapons to the Native forces.

Explanation:

please mark me as brainliest thank you

1. What are Maps? What is the Scale of a map? How does distortion affect maps?

Answers

Answer:

Map projections and distortion. If a map preserves shape, then feature outlines (like country boundaries) look the same on the map as they do on the earth

Map scale refers to the relationship (or ratio) between distance on a map and the corresponding distance on the ground.

A map is a symbolic depiction emphasizing relationships between elements of some space, such as objects, regions, or themes

Explanation:

the total value of goods and services produced in an economy per year is measured by the:
a. unemployment rate
b. gross domestic product
c. consumer price index
d. rate of inflation

Answers

GROSS D Ø M E S T I C PRODUCT

The total value of goods and services produced in an economy per year is measured by the gross domestic product (GDP). Hence option B is correct .

What is  total value of goods and services produced in an economy per year is measured ?

GDP is a macroeconomic indicator that reflects the monetary value of all final goods and services produced within a country's borders in a given period, typically a year.

GDP is calculated by summing up the value of all goods and services produced by individuals, businesses, and the government, including consumption, investment, and government spending, and net exports (exports minus imports). GDP is often used as an important indicator of a country's economic growth and development.

There are three methods for calculating GDP: the expenditure approach, the income approach, and the production approach. The expenditure approach sums up the total spending on goods and services in the economy, the income approach sums up the total income earned by individuals and businesses, and the production approach adds up the total value of goods and services produced by each industry or sector in the economy.

GDP is a crucial measure of economic activity, and changes in GDP can have significant impacts on a country's economy and its citizens' lives, including employment, income, and quality of life.

Learn more about gross domestic product here

https://brainly.com/question/11641137

#SPJ7

HEY CAN ANYONE PLS ANSWER THESE IN UR OWN WORDS!!!

Answers

Answer:

sorry dont know my own words but found this on the web

Explanation:

Third Punic War, also called Third Carthaginian War, (149–146 bce), third of three wars between the Roman Republic and the Carthaginian (Punic) Empire that resulted in the final destruction of Carthage, the enslavement of its population, and Roman hegemony over the western Mediterranean.

Answer:

1. After the third Punic war Scipio the younger and the romans destroyed the city of Carthage in 146 B.C.

2. The romans defeated the people of Carthage. Romans had take prisoners about 50,000 were sold into slavery.

played a role in Imperialism due to the fact that governments believed that if you are going to become more powerful the empire must expand.

Answers

Answer: The Rise of Global Inequality

Explanation:  The Industrial Revolution in Europe marked a momentous turning point in human history. Those regions of the world that industrialized in the nineteenth century (mainly Europe and North America) increased their wealth and power enormously in comparison to those that did not. A gap between the core industrializing regions and the soon-to-be colonized or semi-colonized regions outside the European-North American core (mainly in Africa, Asia, the Middle East, and Latin America) emerged and widened throughout the nineteenth century. Moreover, this pattern of uneven global development became institutionalized or built into the structure of the world economy. Thus a "lopsided world" evolved a world with a rich north and poor south.

In recent years historical economists have charted the long-term evolution of this gap, and Figure 24.1 summarizes the findings of one important study. Three main points stand out. First, in 1750 the average standard of living was no higher in Europe as a whole than in the rest of the world. Second, it was industrialization that opened the gaps in average wealth and well-being among countries and regions. Third, income per person stagnated in the colonized world before 1913, in striking contrast to the industrializing regions. Only after 1945, in the era of decolonization and political independence, did former colonies make real economic progress, beginning in their turn the critical process of industrialization.

The rise of these enormous income disparities, which indicate similar and striking disparities in food and clothing, health and education, and life expectancy and general material well-being, has generated a great deal of debate. One school of interpretation stresses that the West used science, technology, capitalist organization, and even its rational worldview to create massive wealth, and then used that wealth and power to its advantage. Another school argues that the West used its political and economic power to steal much of the world's riches, continuing in the nineteenth and twentieth centuries the rapacious colonialism born of the era of expansion. Because these issues are complex and there are few simple answers, it is helpful to consider them in the context of world trade in the nineteenth century.

How effective were New Deal economic policies in solving the problems of the Depression?

Answers

Answer:

Although the New Deal did not end the Depression, it was a success in restoring public confidence and creating new programs that brought relief to millions of Americans.

Explanation:

Other Questions
what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. NEED HELP ASAP DUE 11:30PM ! Which descriptions of the English colonies in North America are accurate?Choose all answers that are correct.Question 46 options:The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.The men on the Mayflower signed an agreement to write fair laws for the good of the colony.Virginia planters paid English laborers good wages to come work on their plantations.Jamestown was established on good ground near clean water in a healthy environment.Only about 1 in 5, or 20 percent, of early colonists in Virginia survived Match the expression with an equivalent expression 6( n + 4 ) = Can anyone please help me solve this?? A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 How are modern maps and ancient maps similar?a.They both feature three-dimensional drawings.b.They both rely on art and science for mapmaking.c.They both rely on paper-based drawings of an area.d.They both focus on the physical features of an area. 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! i need help lol i forgot how to do this y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line?