Biology High School

What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!

What Two Types Of Consumers Are Missing From This Pyramid?Please Help I Need To Turn It In Today !!!!

Answers

Answer 1

Answer:

decomposers and omnivores

Explanation:

Answer 2
Decomposers and omnivores

Related Questions

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Trees in a temperate deciduous forest compete for all of the following EXCEPT -
A sunlight.
B shelter.
C soil.
D water.

Answers

Answer:

B

Explanation:

Trees needs sun, soil (nutrients), and water to grow and become strong.

I hope this helps ^-^

The answer is b hope this helps trees need soil water and sunlight to grow

3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances

Answers

Answer:

The movement of specific substances into and out of the cell is controlled by the cell membrane.

Explanation:

The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.

when are chromosomes (dna) copied?​

Answers

Answer:

Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.

Have a good day. :)

Answer:

Chromosome replication

Explanation:

Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

THIS IS EARTH SCIENCE
PLEADE ASNWER THE Two QUESTIONS IN THE PICTURE

How do ocean currents affect the coastal regions of S.America at 20 degrees south latitude

When a lake freezes over. How does the energy content of the lake change?

Answers

Answer:

Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies

Question: How do ocean currents affect the coastal regions of S.America at 20 degrees south latitudeAnswer: Warm and cold ocean currents can affect the climate of an area along the coast if the winds blow in from the ocean. Warm ocean currents heat the air above the water and carry the warm air to the land, increasing the temperature of the coastal regionQuestion: When a lake freezes over. How does the energy content of the lake change? Answer: Liquid water has more energy than frozen water. When water freezes it gives up some of the water's energy. This energy that is given up is the latent heat of freezing. When the water was freezing latent heat of freezing energy was being released(WATER IS THE LAKE)Bonus: I know that during melting, there is no temperature change as the heat energy is used to do work against potential bond energy but why doesn't temperature change when freezing? Freezing is the opposite process of melting. If the temperature does not increase as the ice melts, the temperature will not decrease as water freezes. Melting and freezing are entropy changes. Entropy measure the amount of disorder in a system. A system, like ice, which has less freedom of motion, has less disorder. A system, like liquid water, which has more freedom of motion, has more disorder. So water has more entropy than ice. Ice is a very ordered arrangement of H2O molecules in a crystalline form. As heat energy is added to ice, the energy is used the break the bonds between the H2O molecules in the ice crystals. So, the temperature remains constant. You might say that the energy that is added to the ice is used to increase the entropy of the system, instead of increasing the temperature of the system.-TAY brainly please

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?

Answers

Answer:

Fossil fuel

Explanation:

what are cotyledons? & what is its use

Answers

Answer:

Cotyledon, seed leaf within the embryo of a seed. Cotyledons help supply the nutrition a plant embryo needs to germinate and become established as a photosynthetic organism and may themselves be a source of nutritional reserves or may aid the embryo in metabolizing nutrition stored elsewhere in the seed.

*You Can put this in your own words

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

Which of the following best describes natural selection?

A. organisms vary in their physical traits, and some are inherited

B. Organisms compete for food and shelter

C. organisms best suited to their environments are most likely to survive and reproduce

D. Organisms produce more offspring than can survive

Answers

Answer: C

Explanation: according to Darwin, out of the vast no of individuals which compete for a place in the world, only those having advantageous variations survive and reproduce
C remember the key word is natural

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity

Answers

A
It’s the only answer that even makes sense if you really think about it.

Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?

Answers

Answer:

After the Earth, Mars is the most habitable planet in our solar system due to several reasons:

Its soil contains water to extract

It isn’t too cold or too hot

There is enough sunlight to use solar panels

Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to

It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation

The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds

The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!

Additional info:

Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.

Searching for life on Mars

Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.

Other Questions
Worth 50 points and will give brainliest!!!!!What connection to Americas government does the Magna Carta have? provide two reasons why public participation is important for people experiencing lack of basic services What type of person is more likely to bully others? Cups by the water cooler are in the shape of a cone. The height is 15 cm and the diameter is 7.6 cm. What is the volume of one water cooler cup, in cubic centimeters? (Use 3.14 for .) HELP I MARK BRAIN thing Can someone Please help me ? The length of a rectangular swimming pool is exactly three times as longas its width. If the pool has a perimeter of 472m find the width of the pool A family spends 1/10 of it's annual income for housing 1/4 for food and clothing 1/5 for general expenses and 2/15 for entertainment what fractional part of their income is spent on these items altogether. The Albertsons are purchasing a home for $400,000. They are financing 70 percent of the home's value. In addition to the down payment, they have the following closing costs: Lender's inspection fee $400 Loan origination fee 1.5% of the loan amount Notary public fee $60 Document recording fees $75Title search $300 What is the total amount of the closing costs? .help plz Some parents will drive 17 children to summer camp. Each parent can fit 4 children in a car.What is the fewest number of parents needed to drive all the children? In your own words, describe the story of the blind man and the well. How does this story connect to the large global problems we face?Its about billions of changes The tallest Ferris wheel in the world is located in Singapore. Standing 42 stories high and holding as many as 780 passengers, the Ferris wheel has a diameter of 150m and takes approximately 30 minutes to make a full circle. Determine the speed of the riders (in m/s) on the Singapore Flyer. The main function of cell respiration is to produce A. glucose B. NADH and FADH2. C. CO2. D.mitochondria E. ATP.Again No links thank you! The energy that powers photosynthesis comes fromA. oxygen.B. water.C. the sun.D. chemicals. Function (f) is defined by the equation f(x)=3x-7. Find the value of c so that f(c) =20 is true. who was the first person to make the hair dryer?! i need halo asap it is due in 30min Study the graph showing US public opinion from 1965 to 1970.A triple bar graph titled Was Sending Troops to Vietnam a Mistake? The x-axis is labeled Year from 1965 to 1970. The y-axis is labeled Percent of Responders from 0 to 90. The left bar is labeled yes. The middle bar is labeled no. The right bar is labeled no opinion. In 1965, over 20 percent say yes, 60 percent say no, and 15 percent have no opinion. In 1967, 40 percent say yes almost 50 percent say no, and 10 percent have no opinion. In 1970, over 50 percent say yes, over 30 percent say no, and 10 percent have no opinion.Which statement about the Vietnam War is supported by the data in the graph?The war was increasingly unpopular.The wars success led to greater support.The war was of little importance to most Americans.The wars support did not change drastically over time. Convert 77 F into kelvins.Conversion FormulasC = (F - 329) - 1.8Fo= 1.8 x C + 320K= C + 273 Why is the waste going to those countries instead of saying in the United States for recycling? In complete sentences 8. A truck is carrying peach juice, pear juice,and grape juice bottles in a ratio of 4:3:5. Ifthere are 76 peach juice bottles, then how manypear juice bottles are there?