What types of nouns should be used in effective process writing?
Discuss the last time you explained a process to someone at home, at school, or at work
Was your explanation effective?


WILL GIVE BRAINLIST






X







X





X





X
X

X

X
X
X


X

X

X
X
X
X
X

X
X
X

X
X


















X

Answers

Answer 1

Answer:

person place or thing or idea


Related Questions

What is the function of an interjection?

A. To tell a location or time
B. To join two ideas in a sentence
C. To describe a verb or a noun
D. To show emotion or feeling

Answers

B. To join two ideas in a sentence.

The function of an interjection is to show emotion or feeling. They don't follow the remainder of the statement correctly. D is the right option.

The ads within the code you gave are utilized to communicate the taking after feelings:

Wow! - Shocking

Goodness no! - Stun

Goodness, expensive! - Astonish

Here are some more pointers for efficiently using interjections:

Use them in moderation. It's crucial to utilize interjections cautiously since they might be misused. They will lose their impact if you use them excessively.

Use them to convey powerful feelings. Strong emotions are best expressed through interjections. You don't need to use an interjection if you're only a little bit joyful. However, if you're thrilled, adding an exclamation like "Hurray!" may dramatically improve your work.

Hence, the correct option is D. To show emotion or feeling

Learn more about interjection, here:

https://brainly.com/question/1633224

#SPJ6

please help please
Which of the following is NOT a basic belief or practice in Chinese Folk Religions?
Yin and Yang
Fasting
Filial Piety
Ancestor Worship

Answers

Answer:

ancestor worship is your answer to your question you have given

ancestor worship is the answer

Which two methods of performing poetry are most likely to involve musical accompaniment?
a. songs and spoken word
b. slam poetry and spoken word
c. songs and slam poetry
d. slam poetry and poetry readings

Answers

Answer:

songs and spoken word.

Explanation:

The two methods of performing poetry are most likely to involve musical accompaniment as songs and spoken word. Thus the correct option is A.

What is Poetry?

Poetry is referred to as a piece of literature written with the use of lyrical or rhythmic patterns describing events in a melodious manner by reflecting thoughts and emotions to engage the readers effectively.

Lyrics, poems, sketches, and stories were spoken instead of played in spoken word, a literary and performing art. The American Beat Poet movement of the 1940s and 1950s was the predecessor to the spoken word.

A general term for poetry written with performance in mind. Even though certain spoken word poems are sometimes printed on the page, the genre's origins are in oral customs and public performances.

Therefore, option A is appropriate.

Learn more about poetry, here:

https://brainly.com/question/1852007

#SPJ2

Mom and Dad_to work everyday.
Drive or Drives ?

Answers

Answer:

Drive

Explanation:

Answer: Drive

Explanation:

pls help! You want to buy a new cell phone that costs $80 and two new video games that cost $40 each, but you don't have enough money saved for all of it. Which of the following best describes the opportunity costs involved in your purchase decision?

A. If you buy a new cell phone, your opportunity cost is the money you spend to purchase the phone.
B. If you buy two new games, your opportunity cost is the money you spend to purchase the games.
C. If you buy a new cell phone, your opportunity cost is the time you could spend talking on the phone.
D.If you buy two new games, your opportunity cost is the time you could spend talking on the phone.

Answers

Answer:

A

Explanation:

why do you think culture is important​

Answers

Answer:

Provides important social and economic benefits.

Enhances our quality of life.

4. PART B: Which detail from the text best supports the answer to
Part A?
O A “That word – 'guys'– might earn smiles and nods of
understanding in that world, but it brought the ultimate
insult in my neighborhood." ( Paragraph 5)
OB "With one boy in particular, my mother had to sit me down
and explain: 'Son, perhaps there's another reason why his
parents keep making excuses for why we can't get together."
(Paragraph 18)
O c "Painful as some of these experiences were, I was grateful to
have them in middle school and high school, so that when the
time came to head for college, I already had some fluency
navigating between different cultures" ( Paragkaph 12)
OD "I watched as too many others from my hometown and other
predominantly black cities struggled in a university setting
where suddenly they really were a minority." (Paragraph 20

Answers

Answer:

“With one boy in particular my mother had to sit me down and explain.”

Explanation:

Perhaps this one “boy” doesn’t want to be a boy anymore and gets offended when the main character refers to them as a “guy” or was never a guy to begin with. In that case it would make sense that the boy would get offended

Summarize Csikszentmihalyi's argument of FLOW

Answers

Answer:

Explanation:

Cziksentmihalyi defines flow as “a state in which people are so involved in an activity that nothing else seems to matter; the experience is so enjoyable that people will continue to do it even at great cost, for the sheer sake of doing it.”

Battle in your own words sentences

Answers

Answer: We lost many men in the long-lasting battle but in the end, we won. Our bruises and blood were washed away from the glory of winning. The death of our brothers was not in vain.

Which of the following expresses a fact?

Question 2 options:

a)

Eating fast food isn't bad if you only eat it once per week.


b)

Burning the American flag should be a crime.


c)

On average, college graduates earn more money in their lifetimes than high school graduates.


d)

Sometimes curly hair can look better than straight hair.

Answers

Answer:

C

Explanation:

C is a fact and it isnt an opinion

Select the correct text in the passage.
Which statement best shows Brutus's attempt to appeal to his audience?
Julius Caesar
by William Shakespeare

Answers

Answer:

:)

Explanation:

What is correct to say....as a ladies in charge or....as a lady in charge?

Answers

Answer: "as a lady in charge"

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

" as a lady in charge " would be correct

thanks

hope it helps

PLZ HELP IM GIVING 25 POINTS AND BRAINLIEST IF ITS RIGHT ITS READING
The next question refers to This Mystery Rocks! by Cynthia Schlagel.
The sentences have been numbered to help you identify them more easily.

This Mystery Rocks! By Cyntha Schlagel

1The Drifting Rocks are a strange phenomenon still unexplained by science. 2Located in Death Valley, California, the rocks sit on hot, flat ground. 3Unlike normal rocks, they have trails etched behind them as if they have traveled across the sand. 4Some trails are only a few feet. 5Some trails are over a half a mile long. 6Each trail is as baffling as the next.

7The variety of rock movement has baffled scientists for decades. 8Some rocks seem to roll as they move forward. 9Some take unexplainable routes. 10Large ones have traveled past small ones that have stayed still. 11Some scientists suggest that the rocks are pushed by wind. 12Others believe they slide on small amounts of ice or mud. 13So far, research has not confirmed any theory.

Which sentence best identifies the main idea of paragraph two? (4 points)

a
Scientists are baffled by the different ways the rocks move.
b
Scientists are confused by the different ways the rocks move, and theories involving wind, ice, and mud have not been confirmed.
c
Scientists have theories of how the rocks move.
d
The rocks have stumped scientists because some roll, some take unexplainable routes, and some have traveled past ones that have stayed still, but scientists have theories that the rocks are pushed by wind or that they slide on ice or mud.

Answers

Answer:

I would go with A.

Explanation:

The main point of paragraph two is how the rocks move and that scientists are surprised by it. That's the main idea of this paragraph.

PLZ HELP ASAP John Bunyan was imprisoned because he was an Anglican minister.

True
False

Answers

Answer:

true

Explanation:

In the 1600s , the Angelic church was seemed as a treachery because some of it's structure does not fit the Traditional Catholic ( which was was imposed on all England). John Bunyan is one of the most famous Anglican Minister in the Era. A lot of European Angelic Churches honor his death on every August 31st 

Answer:

True

Explanation:

He was very nice and talked slow like Miss Kinnian does and he explaned it to me that it was a raw shok. He said pepul see things in the ink. I said show me where. He said think. I told him I think a inkblot but that wasnt rite eather. He said what does it remind you - pretend something. I closd my eyes for a long time to pretend. I told him I pretned a fowtan pen with ink leeking all over a table cloth. Then he got up and went out. —“Flowers for Algernon, Daniel Keyes

what characterizes Charlie in this passage

description of Charlie
what other people say about Charlie
how Charlie thinks ​

Answers

Answer:

C   ;how Charlie thinks ​

Explanation:

Answer:

The person overtop is right

Explanation:

Just to Clarify.

Question 6
READ ITI
What happens because Kylo tries to get attention instead of being a
team player?
Nico scores the winning goal,
He is not voted Most Valuable Player
Jamol becomes the team's highest scorer
His team loses to the Cougars

Answers

Explanation:

he was not voted most valuable player

True or false: The following sentence is correct?
“In thirty years,” Rodriguez claims, “we will all be in driverless cars.”
Select one:

True


False

Answers

Answer:

true

Explanation:

We can't know what will the next innovation of humanity. We managed to fly to other space, who knows if someone can create a driverless car.

Convert 77° F into kelvins.
Conversion Formulas
C° = (F° - 329) - 1.8
Fo= 1.8 x C° + 320
K= C° + 273

Answers

77° F converts into 298.15 in kelvins

I’m going To need your help on This no links on My question or I will report you

Answers

Answer:

1.D

2.C

3.C

4.B

Explanation:

1. Implode means to get smaller

2. Supernova is a stellar explosion

3. massive is large

4. light year is a time period

1) D. Becomes a tiny dot

2) C. The explosion of a start

3) C. Very large

4) B. How far light travels in one year


Hope this helps, I did my best.

Why is the waste going to those countries instead of saying in the United States for recycling? In complete sentences

Answers

The correct answer to this open question is the following.

Unfortunately, you forgot to include the name of "those countries" that receive the waste from the United States. Without the names, we are limited to fully answer.

However, trying to help you we can comment on general terms based on our knowledge of this topic.

Many times the waste going to underdeveloped o poor countries instead of saying in the United States for recycling is because it is cheaper for the United States to send that waste abroad to those countries. Another reason is that environmental laws in the US are stricter than in other countries, so US industries have to invest more money to comply with United States environment regulations. So these industries prefer to pay to other recycling companies abroad.  

In those other countries, legislation is not as strict as in the US or sometimes environmental legislation is non-existent. The problem is that in these countries people, civilians, suffer the consequences.

Other Questions
what was lady gaga's claim in her lgbtq community speech ? John saved up enough money to buy a $20 can of shoe shine after paying for the $150 pair of Nikes. How much money did he save in all? the rhythmical pattern of the stressed syllables in a poema. proseb. parodyc. symbold. meter Es importante que Uds. ____ (entender) la clase.Ella quiere que Marta ____ (lavar) la ropa.Quiero que tu ____ (comer) algo nutritivo.Ojal que no _____ (llover) esta tarde.Mi madre quiere que yo ____ (comer) frutas.Despus quiere que nosotros _____ (jugar).Mi padre quiere que tu ____ (volver) pronto.Ojal que todos Uds. ____ (ganar) el premio.Es importante que tu ____ (cepillarse) los dientesNo es buena idea que Uds. ____ (llenarse) el estmago con comida. What is sin(77)? plz help Suppose you started a new all-equity financed company that is expected to generate an ROE of 15% indefinitely. The current book value per share equals $30. The required return on the stock equals 12% and you expect to grow at a constant rate of 5% forever. What is the value of the stock of the startup company Need help, please... Which limiting factor is this adaptation a response to An ideal horizontal spring-mass system is set into motion. At an instant when the mass passes through its equilibrium position: The potential energy in the spring is at its _____. The kinetic energy of the mass is at its ______. The magnitude of net force acting on the mass is at its ______. 2. Which ethic do you think is most important for a journalist to have? Why? Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800?