what was the result of the issue from the election of 1800?

Answers

Answer 1

Answer:

"The 1800 election result revealed a serious flaw in the U.S. Constitution, which said that candidates for president and vice president ran on the same ballot, which meant running mates could be running against each other. The 12th Amendment, which changed the Constitution to prevent the 1800 election problem from recurring..."

Explanation:

The Controversial Election of Thomas Jefferson in 1800


Related Questions

1) Choose the correct answer. I NEED HELP ASAP


The destination of many Roman Catholic pilgrimages was ______.

the Holy Land

the Holy Roman Empire

Africa

Kiev

Rome

Answers

Answer:I think its holy land

Explanation:

throughout the centuries, pilgrimage destinations have expanded greatly, going well beyond the three main destinations — the Holy Land, Rome, and the Camino de Santiago.

Which of the following is not an example of a check or balance put into the U.S. Constitution?
A. Congress confirms a judicial appointment.
B. President vetoes a bill sent to him from Congress.
C. Congress reviews a judicial decision and overturns the Supreme Court ruling.
D. The president issues a pardon or commutes someone's sentence.

Answers

Answer:

Congress reviews a judicial decision and overturns the Supreme Court

Explanation:

How is the president elected?

Answers

Did you talk about the new president?

examine figure 2. the maxim gun was one of the first machine guns invented, and WWI was the first war to be fought using machine guns. what effects do you think the use of maxim gun in WWI had on the number of casualties (deaths and injuries) ?

Answers

Answer:

The Maxim Gun had taken an extreme toll of casualties due to the way of warfare during World War One. As waves upon waves of soldiers would attack the other sides trench, the Maxim Gun had kept the aggressors in bay. Not like a conventional rifle with one shot then cocking your gun, the Maximum Gun had sprayed bullets everywhere it aimed taking down a vast amount of soldiers. This gun was revolutionary as it was the first fully automatic weapon.

1) Using this map of the major engagements of the War of 1812, which of
these BEST describes where these battles took place?
A)
in the Southern United States
B)
along the West Coast of the United States
C)
along the East Coast of the United States
D) in the Great Lakes region of the United States

Answers

Answer:

i think the answer is b

Explanation:

Along the West Coast of the United States is best describes where these battles took place in the map. Hence, option B is correct.

What is meant by  West Coast?

The term typically refers to California, Oregon, and Washington, the three contiguous states of the United States, although it can also occasionally refer to Alaska and Hawaii, particularly when used by the United States Census Bureau to define a region of the nation.

Of or relating to the western coast of the United States. A region in the western United States that is home to California, Oregon, and Washington and borders the Pacific Ocean.

While the term "East Coast" refers to the easternmost states in the U.S. that stretch from the Atlantic Ocean in the east to Canada in the north, "West Coast" refers to the westernmost coastal states that touch the Pacific Ocean. 2.

Thus, option B is correct.

For more details about West Coast, click here:

https://brainly.com/question/20522985

#SPJ2

5. What are some things that you can do to prevent prejudice and bigotry in your school, community, society, and beyond? What are some things that your teachers, parents, religious and community leaders can do?

Answers

Answer:

welp i cant leave this blank lol ill just put in explanation

Explanation:

what YOU can do is start a inclusive club (LGBTQ club that sorta stuff) in your school or make it a community group and draft letters to your officails to find a way to stop bigotry in your state/area. what ADULTS can do adults can run for offices and change or add rules they can also provide funding for groups that kids made.

Which of the following piece of legislation most likely funded the project that gave this man a job? Use the picture to answer the question.
Glass-Steagal Act
Civilian Conservation Corps Relief Act
National Industrial Recovery Act
Emergency Banking Act

Answers

Answer: B. Civilian Conservation Corps Relief Act

Explanation:

Answer:

Federal Emergency Relief ActExplanation:

PLEASE HELP!

Do you think the Compromise of 1850 was enough to resolve the differences
between North and South?

In one paragraph, explain why or why not.

Answers

No, the compromise of 1850 was not enough to resolve the differences between the north and south because geographical differences remained. A huge factor of why slavery was an issue was because the south needed slaves to work the land. Meanwhile, the north mainly industrial thrived on factories and therefore didn’t need slaves. Furthermore, the compromise of 1850 brought upon the Fugitive slave act of 1850 which was not enforced by the north. This clearly shows the differences in ideology between the north and the south that even to this day haven’t truly been resolved.

The compromise of 1850 was the bill passed by the US for the confrontation between slaves and the state. The compromise was unable to resolve the regional conflict in the US.

What was the 1850 compromise effect?

The 1850 compromise was insufficient to reconcile the north and south because geographical differences still existed, and thus did not resolve the differences.

The south required slaves to work the land, which was a major factor in the abolition of slavery.

Meanwhile, the predominantly industrial north thrived on factories and thus did not require slaves.

Furthermore, the 1850 compromise resulted in the 1850 Fugitive Slave Act, which was not enforced by the north.

This clearly demonstrates the ideological differences between the north and the south, which have yet to be resolved.

Learn more about the 1850 compromise, here:

https://brainly.com/question/8165267

According to the 2010 U.S. Census, what percentage of people live outside of metropolitan areas in Texas?

Answers

12%

The Vast majority of Texans live in metropolitan areas(88%). That Number isn't likely to change much by 2050

HELPPPP PLEASEEEEEE


Although scholars debate the exact numbers, in Alvin Josephy's estimate, the Indian population fell from between fifteen and twenty million when the white man first arrived to a fraction of that 150 years later. Undoubtedly the Indians perished in great numbers. Yet although European enslavement of Indians and the Spanish forced labor system extracted a heavy toll in lives, the vast majority of Indian casualties occurred not as a result of hard labor or deliberate destruction but because of contagious diseases that the Europeans transmitted to the Indians. The spread of infection and unhealthy patterns of behavior was also reciprocal. From the Indians the Europeans contracted syphilis. The Indians also taught the white man about tobacco and cocaine, which would extract an incalculable human toll over the next several centuries. The Europeans, for their part, gave the Indians measles and smallpox. (Recent research has shown that tuberculosis predated the European arrival in the new world.) Since the Indians had not developed any resistance or immunity to these unfamiliar ailments, they perished in catastrophic numbers.
-- From ‘The Crimes of Christopher Columbus’ by Dinesh D'Souza, 1995

The author of this article believes that the Native American population declined greatly mostly because of

A.
enslavement, mistreatment, and hard labor.

B.
lack of immunity to some diseases.

C.
violent conflict.

D.
unhealthy patterns of behavior.

Answers

Answer: A

Explanation:

b because it tell what really happened

The work that the congressmen do to help out constituents with problem is called:

A.Constituents
B.Casework
C.Pork-Barrel Projects
D.Franking Privilege

Answers

The work that the congressmen do to help out constituents with problem is called:

Answer is B

Complete all questions.

What was the main purpose of the Mayflower Compact?
What was the main motivation for the settlement of the Plymouth Colony, Maryland, and Pennsylvania?
Why were Africans changed from initially being indentured servants to slaves?
The purpose of the “Join or Die” flag (created by Ben Franklin in 1750).
The Albany Plan of Union called for doing what with the 13 colonies?
The proclamation line of 1763 did what to the relationship between the crown and those living in the colonies?
Even though they declared independence, the debate over what lasted into the 1800s?
Why were colonial boycotts so effective?
In the war for independence the first major fighting was at ___________ and ___________. The last major battle was at ___________ Virginia.
What was the major achievement of the government under the articles of confederation?
How does the judicial branch check the legislative branch?
Checks and balances were put in the constitution for what reason?
Why did delegates of the constitutional convention (1787) write a new constitution?
What was the 3/5s compromise?
What came from the whiskey rebellion? What did it show?
In Washington’s farewell address, he advocated for what (regarding foreign policy)?
What was controversial about the Alien and Sedition acts?
The Louisiana purchase was important to America because?
Why was the Embargo act bad for America?
Lewis and Clark were tasked with exploring the new lands and creating what?
What happened between Aaron Burr and Alexander Hamilton?
After the War of 1812 America started protecting whom?
During the War of 1812, what did the British do to the White House?
What General became famous for standing up at the Battle of New Orleans and leading the USA to a decisive victory over Great Britain?
Why did some feel the Missouri compromise would deepen sectional tensions?
Andrew Jackson went to “war” over all of the following issues except-
Nullification crisis, bleeding kansas, war with the Bank of the US (BUS), Indian Removal Act
What was the trail of tears?
The Seneca Falls Convention, which took place in 1848, focused largely on what?
What was the name of the old mission that Davy Crockett and other Texans used as a fort against the Mexican military?
The Mexican-American War added land which increased sectional issues, how?
The primary cause of the Mexican-American War was land/border disputes and the annexation of what territory?
The primary goal of manifest destiny was?
What did the Fugitive Slave Act do?
How did Dred Scott V. Sanford (1857) increase sectional tension?
What was John Brown’s role in bleeding kansas?
How was the 1860 presidential election a turning point in American history?
Lincoln wanted to first and foremost preserve the ________________?
How did the signing of the emancipation proclamation help prevent Britain and France from helping the confederacy?
What was the turning point of the Civil War?
Who was John Wilkes Booth and what did he do?

Answers

Answer:

1.The Mayflower Compact created laws for Mayflower Pilgrims and non-Pilgrims alike for the good of their new colony.2.Most of the citizens of Plymouth were fleeing religious persecution and searching for a place to worship as they saw fit, rather than being entrepreneurs like many of the settlers of Jamestown in Virginia.4.The Albany Plan of Union was a plan to create a unified government for the Thirteen Colonies, suggested by Benjamin Franklin, then a senior leader (age 48) and a delegate from Pennsylvania, at the Albany Congress on July 10, 1754 in Albany, New York

List 3 things that missions were expected to accomplish

Answers

Answer: 1. They hoped to create a Utopian Society

         That's one. (At least I'm guessing it is), try to solve the other ones from your textbook, they always have the answers, no matter how well hidden it is :)

After the Revolutionary War the British were eager to trade with the powerful United States True False​

Answers

Answer:

true

Explanation:

Britain spent a huge amount of money fighting the Revolutionary War, sending the national debt soaring and creating a yearly interest of nearly 10 million pounds. ... British trade with the new USA rose to the same level as trade with the colonies by 1785, and by 1792 trade between Britain and Europe had doubled

Please select the word from the list that best fits the definition
the art of folding paper

Answers

Answer:

origami

explanation:

Answer:

dude someone deleted my answer but yea its origami

Explanation:

Some one plzzzz help
Which diagram best connects a Central Asian country with an important
event from its history?
O

A
Afghanistan
Was part of the
Ottoman Empire through
World War I

B.
Kyrgyzstan
Fought a war against
Azerbaijan in the 1990s

c.
Kazakhstan
Was led by a communist
leader after the fall of the
Soviet Union

D.
Armenia
Was part of the British
Empire until after the
Cold War

Answers

Answer:

C

Explanation:

Nursultan Nazarbayev was the leader of kazakhstan following the collapse of the soviet union.

Answer:

Its C

Explanation:

did the test !!

After the War of 1812, the United States was seen as a greater military power because
it had won the war.
there was no clear winner.
US land troops performed well.
it had defeated American Indians.

Answers

Answer:

it had won a war against the largest military force at the time

Explanation:

Answer:

there was no clear winner

Explanation:

Edge2020

What problem does the miller's daughter face at the beginning of the story?
She does not love the king, but her father has threatened to kill her if she does not marry the king
She is afraid of the little man, but he is the only one who can spin straw into gold for her.
She does not know how to spin straw into gold, but the king has threatened to kill her if she does not spin his straw into gold,
She wants her necklace and ring back, but she has already given them to the little man in exchange for his help

Answers

Answer:

wish i could help sorry have a great day

Explanation:

The Caddos were part of what larger and more skilled group?
Iroquois
O Cherokee
Alabamian
o Mississippian
NEXT QUESTION
© ASK FOR HELP

Answers

Answer:

Mississippian

Explanation:

type of American Indian dwelling in
the Eastern Woodlands

Answers

Answer:

The wigwam is the answer you are looking for.


In a relationship with low amounts of equity, both individuals equally contribute to making important decisions.
Please select the best answer from the choices provided
OT
OF

Answers

Answer:

False**

Explanation:

Because of low amounts of equality their will be inequality

In a relationship with low amounts of equity, both individuals equally contribute to making important decisions. The statement is false.

What is a relationship foundation?

A relationship is based on th pillars of trsut and understanding where both partners shared common beliefs and hobbies with their own perspectives. Relationships that live longer are based on understanding, care, respect, and responsibility toward each other.

It defines a relationship where equality and respect are subordinated to power and control. Relationships are unequal if one partner's needs take precedence over the other's without any thought for yours.

Power disparities between partners are referred to as inequality in relationships. One spouse maintains authority and authority over the other in an unhealthful relationship.

Therefore, the statement is False.

Learn more about Relationships, here:

https://brainly.com/question/15211678

#SPJ7

Subject is science why is satellites an example of solar energy

Answers

Answer: because satellites are using the sun's energy to power whatever needs to be powered

Explanation:

Select the correct answer.

The Taft-Hartley Act intended to do which of the following?


A.

curb the laws that gave too much power to union leaders

B.

grant US veterans benefits upon returning home

C.

provide companies with a way to acquire immigrant labor

D.

give women workers more rights in World War II factories

20 pts if anyone can help me....

Answers

The Taft-Hartley Act was meant to curb the legal guidelines that gave an excessive amount of power to union leaders.

What is the Taft-Hartley Act?

The Labor Management Relations Act of 1947, also called the Taft–Hartley Act, is a United States federal regulation that restricts the sports and electricity of labor unions.

It was enacted with the aid of the eightieth United States Congress over the veto of President Harry S. Truman, turning into regulation on June 23, 1947.

Taft–Hartley was added in the aftermath of a first-rate strike wave in 1945 and 1946. Though it was enacted with the aid of the Republican-managed eightieth Congress.

The regulation obtained good sized help from congressional Democrats, many of whom joined with their Republican colleagues in balloting to override Truman's veto.

The act continued to generate competition after Truman left office, but it stayed in effect. The Taft–Hartley Act amended the 1935 National Labor Relations Act (NLRA), prohibiting unions from engaging in numerous unfair labor practices.

Jurisdictional strikes, wildcat strikes, political strikes, secondary and mass picketing, and economic donations to federal political campaigns using unions are among the practices prohibited by the Taft–Hartley Act.

The NLRA additionally allowed states to enact right-to-paint legal guidelines banning union shops. The regulation was enacted all through the early levels of the Cold War.

Therefore, from the above assertions, it's clear that choice A, decreasing the legal guidelines that gave an excessive amount of power to union leaders, is the ideal choice.

Learn more about Taft-Hartley Act, refer to:

https://brainly.com/question/10748899

Why was minimum wage put in place in Ontario in 1920

Answers

Answer: 16 cents per hour

Explanation: During the great dipression.

$.16 per hour you’re welcome

Unlike the American Revolution, the Haitian was

A. Unsuccessful

B. Led by masses of poor people

C. Fought against the United States

D. Achieved through armed resistance

Answers

Answer:

B. Led by masses of poor people

Explanation:

The Haitian Revolution has often been described as the largest and most successful slave rebellion in the Western Hemisphere. It was a successful anti-slavery by self-liberated slaves against French colonial rule in Saint-Domingue. The ideas of the French Enlightenment philosophes strongly influenced the American revolutionaries. The 13 eastern colonies demanded democratic government, and went to war against Britain in 1775. This lead to the signing of the Declaration of Independence in 1776.

Which of the following is NOT a possible verdict following jury deliberations?
A.
guilty
B.
not guilty
C.
delayed decision
D.
hung jury

Answers

It’s delayed decision cause the judge can only do that

Answer:

you answer is C

Explanation:

i got it right on the unit test

5. What countries were permanently part of the Axis Powers?

Answers

Answer:

Germany Italy and Japan during ww2

Explanation:

Axis powers, coalition headed by Germany, Italy, and Japan that opposed the Allied powers in World War II.

Source - Britannica

What is “wrong” with the linear view of societal development?

Answers

Answer:

Development of what people stand for can be pretty screwed up, especailly in the American government of BOTH political parties. Democracy is a fragile thing and can be taken backwards very easily. Other nations as well depending on what leaders make of society and how they think it should be.

If the can has not opened, then its
has not changed.

Answers

Answer:

that is corect but.......... oh and sorry for the bad spelling

Explanation:

what was the New Jersey plan and the Virginia plan?​

Answers

The Virginia Plan proposed a bicameral legislature, a legislative branch with two chambers. ... Under the New Jersey Plan, the unicameral legislature with one vote per state was inherited from the Articles of Confederation. This position reflected the belief that the states were independent entities.

Answer:

Explanation:

The Virginia Plan proposed a bicameral legislature, a legislative branch with two chambers. ... Under the New Jersey Plan, the unicameral legislature with one vote per state was inherited from the Articles of Confederation. This position reflected the belief that the states were independent entities.

Other Questions
According to the segment, what percentage of your wardrobe should be fads?A)Fifty percentB)Forty percentC)Thirty percentD)Twenty percent What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. NEED HELP ASAP DUE 11:30PM ! Which descriptions of the English colonies in North America are accurate?Choose all answers that are correct.Question 46 options:The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.The men on the Mayflower signed an agreement to write fair laws for the good of the colony.Virginia planters paid English laborers good wages to come work on their plantations.Jamestown was established on good ground near clean water in a healthy environment.Only about 1 in 5, or 20 percent, of early colonists in Virginia survived Match the expression with an equivalent expression 6( n + 4 ) = Can anyone please help me solve this?? A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 How are modern maps and ancient maps similar?a.They both feature three-dimensional drawings.b.They both rely on art and science for mapmaking.c.They both rely on paper-based drawings of an area.d.They both focus on the physical features of an area. 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas!