What’s the answer help please !

Whats The Answer Help Please !

Answers

Answer 1

Answer:

30

Step-by-step explanation:

Answer 2
I am pretty sure that the answer is D.)
But don’t quote me.

Related Questions

Please help with this

Answers

Answer:

A. x = 5, -3

Step-by-step explanation:

The quadratic equation/formula is:

[tex]x = \frac{-b+- \sqrt{b^2 - 4ac} }{2a}[/tex]

The setup is:

[tex]ax^2+bx+c=0[/tex]

[tex]4x^2 - 8x -60=0[/tex]

Plug in the numbers according to the letter associated:

[tex]x = \frac{8+-\sqrt{-8^2-4(4)(-60)} }{2(4)}[/tex]

[tex]x = \frac{8+-\sqrt{1024} }{8}[/tex]

[tex]x = \frac{8+-32}{8}[/tex]

Solve for addition and subtraction:

[tex]x = \frac{8+32}{8}[/tex]                                                                              [tex]x = \frac{8-32}{8}[/tex]

[tex]x = \frac{40}{8}[/tex]                                                                                  [tex]x = \frac{-24}{8}[/tex]

x = 5                                                                                      x = -3

A moving company charges $0.60 per pound for a move from New York to Florida. A family estimates that their belongings weigh about 6 tons. About how much would it cost to family to move from New York to Florida?

Answers

Answer:

this is wrong sry

Step-by-step explanation:

Answer:

$7,200

Step-by-step explanation:

1 ton is 2,000 pounds so 6 tons would be 12,000 pounds. Multiply that 0.60 and you get 7,200.

what is the volume of the figure below.​

Answers

Answer:

146,452

Step-by-step explanation:

X-1/x-1=1 what is the answer????

Answers

Answer:

0

Step-by-step explanation:

×-1/×-1=1

×-1=1(×-1)

×-1=×-1

×-×=-1+1

0=0

0

The value of the equation is 1.

The equation given is (x-1)/(x-1) = 1.

To determine the solution, we can simplify the equation by canceling out the common factor (x-1) on both sides:

(x - 1)/(x - 1) = 1

1 = 1

The simplified equation 1 = 1 is always true for any value of x.

Therefore, the original equation is true for all values of x, except when x = 1.

When x = 1, the equation is undefined because the denominator becomes zero, resulting in division by zero.

Hence the value of the equation is 1.

Learn more about equation click;

https://brainly.com/question/29657983

#SPJ2

Find the area. Will mark brainliest.

Answers

Answer:

337.5

Step-by-step explanation:

You need to add 10 to the height then multiply 25 times 27 then divide by 2.

Hope this helps.

Answer:

212.5 cm² and 120 in²

Step-by-step explanation:

The area (A) of a triangle is calculated as

A = [tex]\frac{1}{2}[/tex] bh ( b is the base and h the perpendicular height )

(4)

Here b = 25 and h = 17, thus

A = 0.5 × 25 × 17 = 212.5 cm²

(5)

Here b = 12 and h = 20, thus

A = 0.5 × 12 × 20 = 6 × 20 = 120 in²

(A) 10
(B) 8
(C) 16
(D) 3

Answers

Answer:

8

Step-by-step explanation:

10 to big 16 to large 3 to small 8 just right

I need the answer ASAP! Thanks! ❤️

Answers

Strong and positive
Your answer will be sting and positive

Which equation in point-slope form contains the points (0,5) and (5,8)?
A. y - 8 = (x - 5)
B. y - 5 = (x – 8)
c. y - 8 = {(x - 5)
D. y - 5 = (x – 8)

Answers

I'm going to assume you pasted the question and answers and the fractions for the slope didn't come up.

Solve for the slope using the given values.

Slope formula: y2-y1/x2-x1

= 8-5/5-0

= 3/5

Point slope form: y - y1 = m(x - x1)

Using the point (5, 8) and the slope (3/5), it should look like:

y - 8 = 3/5(x - 5)

Best of Luck!

Type the correct answer in the box. Use numerals instead of words.
Jim Is assessing the popularity of his high school football team's website for the first 5 weeks after the season ends. The average number of visits
on the website for 5 weeks is given in the table below.
Number of Weeks Avg. Number of Visits
0
48,000
1
24,000
2
12,000
3
6,000
4
3,000
1,500
5
9.
The percent decrease in the average number of visits each week since the end of the season was

Answers

Answer:50%

Step-by-step explanation:

Each week the number decreased by 1/2 which is equal to 50%. Therefore the average number of decrease per week is 50%. Hope this helped!!

could I by any chance get a brainliest?

The percent decrease in the average number of visits each week since the end of the season was 50%.

What is Statistics?

Statistics is the discipline that concerns the collection, organization, analysis, interpretation, and presentation of data.

Jim is assessing the popularity of his high school football team's website for the first 5 weeks after the season ends.

The average number of visits on the website for 5 weeks is given

The average number of visits decreased by half each week.

So the percent decrease in the average number of visits each week since the end of the season was 50%

Therefore, the percent decrease in the average number of visits each week since the end of the season was 50%.

To learn more on Statistics click:

https://brainly.com/question/30218856

#SPJ7

Jill charges an hourly rate for babysitting one or two children. Kara charges a lower hourly
rate but adds an additional charge for more than one child.
The tables show the amounts Jill and Kara charge for babysitting two children for up to three
hours. Based on this information, which statement is true?

Answers

Answer:

b

Step-by-step explanation:

Answer:

B

Step-by-step explanation:

Complete the statement with the choice that best
describes the relationship between the polynomial
and its rational zeroes.
A polynomial, P, has a leading coefficient of 1 and
a constant term. The rational roots of Pare all

Answers

Answer:

Factors of the constant term

Step-by-step explanation:

the answer is "factors of the constant term"! i hope this helped

Kyleigh put a large rectangular sticker on her notebook.the height of the sticker measures 10 cm. the base is half as long as the height. what area of the notebook does the sticker cover?

Answers

Hey there! Welcome to Brainly! I'm happy to help you!

When we are talking about the height and base, let's use the variables h and b. With the information we have been given, we can make the following equations below.

h=10                     (the height is 10)

b=h/2            (base is half as long as the height)

We see that h is equal to ten. b is equal to h divided by two, so it is therefore ten divided by 2! We take the value for h and the plug it into the second equation!

b=10/2

b=5

So, we now know that the height is 10 cm and that the base is 5 cm. However, we need to find the area. To find the area of a rectangle, we just multiply the base by the height!

10(5)=50

Therefore, the area of the sticker is 50 cm².

I hope that this helps! Have a wonderful day!

It's Quadratic, Exponential or Linear?​

Answers

Answer:

quadratic table

Answer:

i think it is exponential

help asap will mark brainliest

Answers

Answer:

74

Step-by-step explanation:

Both angles x and 106 are supplementary which means

x+106=180

x=180-106

x=74

Answer:

74°

Step-by-step explanation:

In the image you have provided, angle 'x' and 106° are co-interior angles. This mean that both the angles add up to 180°. We can easily identify co-interior angles because the angles would be inside. The other types of angles you can get is vertical and corresponding. Using the information in the second sentence we can set up an equation,

⇒ Form an equation

→ x + 106 = 180

⇒ Minus 106 from both sides to isolate x

→ x = 74°

The values of angle x is 74°

To apply frosting to a cake, a baker twists a plastic bag containing the frosting into a cone shape with a diameter of 4.2 inches and a length of 6 inches. How many cubic inches of frosting is in the bag? Use 3.14 for pi.

Answers

Answer:27.7

Step-by-step explanation:

the formula for a cone is V=1/3πr*2h

it is 1/3 because a cone is one-third of a sphere.

you then put the information from the text in the formula and you get this

V=1/3x 3.14 (pi) x 2.1 to the power of 2 (radius is half of a diameter)x 6 (height)

then you get the answer 27.6948

round to the nearest 10th and you get

A. 27.7

Also, I took the test.

There are 27.77 in³ of frosting is in the bag.

What is volume?

The amount of space, measured in cubic units, that an object or substance occupies.

Given that, To apply frosting to a cake, a baker twists a plastic bag containing the frosting into a cone shape with a diameter of 4.2 inches and a length of 6 inches.

Volume of cone = ¹/₃πr²h

r = 4.2/2 = 2.1 in

h = 6 in

Volume = ¹/₃x2.1x2.1x6

= 27.77

Hence, the volume of the cone is 27.77 in³

For more references on the volume, click;

https://brainly.com/question/1578538

#SPJ1

For the relation S:{(2,3),(−1,4), (1,6)}. a Find the domain. B. Find range

Answers

Answer:

domain: {2, -1, 1}

range: {3, 4 6}

Step-by-step explanation:

In the relation of the form (x,y)

Set of all possible value of X is called Domain

Set of all possible value of Y is called  Range

To get a list of domain and range it is required to separate value of x and y

_________________________________

Relation given in the problem

S:{(2,3),(−1,4), (1,6)}

domain: {2, -1, 1}

range: {3, 4 6}

Put in order rational numbers

Answers

Answer:

[tex]-\frac{26}{40}[/tex]

[tex]-\frac{9}{20}[/tex]

[tex]\frac{12}{25}[/tex]

Step-by-step explanation:

Divide each individually.

[tex]-\frac{9}{20}=-0.45[/tex]

[tex]\frac{12}{25}= 0.48[/tex]

[tex]-\frac{26}{40}=-0.65[/tex]

Since you have to order them from least to greatest, begin by the negative number that is farthest from 0. In this case, -0.65, the next negative number would be -0.45 and finally we only have one positive number 0.48

Find the midpoint between the points (-6, -2) and (-3, -7)

Answers

The midpoint is (-9/2, -9/2)

Answer:

(-4.5, -4.5)

Step-by-step explanation:

To find the midpoint add the x coordinates and divide by 2

(-6+-3)/2 = -9/2 = -4.5

Then add the y coordinates and divide by 2

(-2+-7)/2 = -9/2 = -4.5

Use the proof to answer the question below.
Given: AB || DE and ZA = LC
Prove: M4BC - ADEC

a. SAS
b. AA
c. SSS
d. AAS

Answers

Answer:

if B is AAA then that is correct

Step-by-step explanation:

which expression can be used to find the value of x in the triangle shown part b write the value of x to the nearest tenth?

Answers

Answer:

where is the image?

Step-by-step explanation:

i need an image ! :)

find the area of the figure please <3

Answers

the answer is sjsu’s has
The area should be 150 units

Area of A = 10x10 =100
Area of B = (10x10) /2 = 50

A+B = 150

Which equation is graphed along with the parent
function?

g(x)= ^3 √x+3 +4
g(x)= ^3 √x-3 +4
g(x)= ^3 √x-4 +3
g(x)= ^3 √x+4 +3

Answers

Answer:

B.g(x) = RootIndex 3 StartRoot x minus 3 EndRoot + 4

Step-by-step explanation:

Equation, graphed along with the parent function is g(x) = ∛(x-3) + 4

The correct option is B.

What is graph of a function?

The graph of a function f is the set of all points in the plane of the form (x, f(x)). We could also define the graph of f to be the graph of the equation y = f(x).

Given,

Graph of a parent function

and equation is graphed along with the parent function

Parent function

f(x) = ∛x

By the graph,

There is 3 unit horizontal shift to positive side, and 4 unit vertical shift to upwards in parent function

Thus, function drawn along with it is

g(x) = ∛(x-3) + 4

Hence, g(x) = ∛(x-3) + 4 is the equation, graphed along with the parent

function.

Learn more about graph of function here:

https://brainly.com/question/9834848

#SPJ2

Someone please explain these questions

Answers

Use a graphing calculator

Answer: You find it by using slope

Step-by-step explanation

If the graph is rising from left to right, like climbing a hill, the slope is positive (on a graph, you could count up y units divided by right x units). If it is going down from left to right (like sliding down a hill), the slope is negative (on a graph you have to count down y units and right x units).

ex: y = 5x + 3 is an example of the Slope Intercept Form and represents the equation of a line with a slope of 5 and and a y-intercept of 3. y = −2x + 6 represents the equation of a line with a slope of −2 and and a y-intercept of 6.

Members of alachua district choir were asked, when given the choice between romanticism or gothic style singing, which style they preferred to sing for state competition. The data was broken down by gender

Answers

The question is incomplete, so here is the complete question.

Members of alachua district choir were asked, when given the choive between romanticismor gothic style singing, which style they preferred to sing for state competition. The data was broken down by gender:

48 males preferred Romanticism

63 males preferred Gothic

59 females preferred Romanticism

62 females preferred Gothic

Part A: Fill in and complete the following contigency table. Circle the largest  joint frequency and put a box around the smallest marginal frequency.

                    Romanticism         Gothic            Total

Males

Females

Total

Part B: Which style was preferred as the state competition piece and by what percentage?

Part C: Which subject was preferred the most by Males?

Part D: What frequency does 125/232 represent?

Answer and Step-by-step explanation:

Part A:

             Romanticism        Gothic       Total

Males            48                     63            111

Females        59                     62           121

Total              107                   125         232

Part B: The preferred style is Gothic by a percentage of

P = [tex]\frac{125}{232}[/tex]

P = 54%

Part C: According to the table, the style preferred the most by males was Gothic, since 63 males chose it over 48 that chose Romanticism.

Part D: The frequency 125/232 represents the total of people (male AND female) that preferred Gothic over the total of people in both categories.

Somebody help I’ve tried this question many times and still get it wrong

Answers

Answer:

$480 in interest to make a total of $1,480. She will not have enough money

Step-by-step explanation:

I=P.r.t

=1000*0.02*24

=$480

Total after 2 years: 1000+480=$1,480

Help! I don't know how to do this! I will mark Brainliest!

Answers

Answer:

- 3y² - 7y + 6

Step-by-step explanation:

Given

(- 3y + 2)(y + 3)

Each term in the second factor is multiplied by each term in the first factor, that is

- 3y (y + 3) + 2(y + 3) ← distribute both parenthesis

= - 3y² - 9y + 2y + 6 ← collect like terms

= - 3y² - 7y + 6

Answer:

is it A?

Step-by-step explanation:

i choose that because its the only one with -3y² which is correct

What represents the product of x AND y + 4?

xy+4x
xy+4
x+y+4
x+4y

Answers

Answer: A. xy + 4x

Step-by-step explanation:

(x)(y + 4)

distribute the x to both terms

xy + 4x

hope this helps! :)

Answer:

A. xy + 4x

Step-by-step explanation:

(x)(y + 4)

distribute the x to both terms

xy + 4x

Half of a sphere is stacked on top of a cone. They both share a circular base. The radius of the circle is 6 millimeters. The height of the cone is 14 millimeters.
What is the volume of the composite figure? Express the answer in terms of π.

144π mm3
168π mm3
312π mm3
456π mm3

Answers

Answer:

312π mm3

Step-by-step explanation: yes

The required volume of the composite figure of the sphere on the top of the cone is 312π mm³. Option c is correct


The sphere is stacked on top of a cone. They both share a circular base. The radius of the circle is 6 millimeters. The height of the cone is 14 millimeters. The volume of the composite figure is to determine.


What is volume?

Volume is defined as the ratio of the mass of an object to its density.

Volume of composite figure =  Volume of semi-sphere  + Volume of cone
                                              =   2/3πr³ + 1/3πr²h
                                              =  2/3*6³π + 1/3*6²*14π
                                              =   312π mm³

Thus, the required volume of the composite figure of the sphere on the top of the cone is 312π mm³.

Learn more about Volume here:
https://brainly.com/question/1578538

#SPJ5

Simplify the expression. What classification describes the resulting polynomial?

Answers

Answer:

A quadratic Trinomial

Step-by-step explanation:

hope this helps

Given

(3x² - 11x - 4) - (2x² - x - 6)

Distribute both parenthesis, noting the second is distributed by - 1

= 3x² - 11x - 4 - 2x² + x + 6 ← collect like terms

= x² - 10x + 2 ←  this is a quadratic with 3 terms, thus trinomial → A

Answer: i believe the answer would be a quadratic trinomial.

Step-by-step explanation:

You decide to borrow money to pay for college at 22% interest per year, in 2023.
How much will you owe on a loan of $5,000 in 2027?

Answers

Answer: On  loan of $5000 at that rate, you would be owing $9400

Step-by-step explanation: The loan is being borrowed at an interest rate that is calculated yearly. This is a case of a simple interest. The same amount of interest is calculated and that will be payable per year. The amount borrowed is the principal, and in this instance is $5000. The amount of interest payable is calculated as 22 percent of the principal and is paid yearly. So if a loan (principal amount) of $5000 is borrowed for a period of 4 years (that is, 2023 to 2027), then the interest is calculated for four years.

Hence, the formula for a simple interest computation is given as follows;

Interest = P x R x T

Where P = 5000, Rate = 0.22 (22 percent), and T = 4 (time in years)

Interest = 5000 x 0.22 x 4

Interest = 20000 x 0.22

Interest = 4400

Therefore, from the calculations shown, a loan of $5000 at the rate of 22% borrowed from 2023 to 2027 would have an interest payable of $4,400.

Upon repayment of the loan, you would be owing a total of $9,400 (that is, amount borrowed plus interest owing)

Other Questions
How does the narrator repeating My favorite at the beginning of every paragraph contribute to the story? (My favorite things by joy cowley) If 14 moles of Oxygen burn how many moles of water are created? *2C2H6+7024CO2 + 6 H2OA) 12 mol H20B) 3.5 mol H20C) 3 mol H20D) 42 mol H20 2x +6 = 8xwhat are the values of x here? can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Dextra Computing sells merchandise for $15,000 cash on September 30 (cost of merchandise is $12,000). The sales tax law requires Dextra to collect 5% sales tax on every dollar of merchandise sold. Record the entry for the $15,000 sale and its applicable sales tax. Also record the entry that shows the payment of the 5% tax on this sale to the state government on October 15. View transaction list Journal entry worksheet Record the cost of September 30th sales. Note: Enter debits before credits Date General Journal Debit Credit Sep 30 Record entry Clear entry View general journal Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG brainliest & points!i need help with math asap, show work too if possible :) Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) Which statement is the correct solution? Davi has 75 flower seeds. He wants to plant the seeds in pots so that every seed is planted, and every pot hasthe same number of seeds. In the 1994 elections, Republicans won a clearmajority in states. Which of these tables lists all the possible outcomes of flipping 3 coins? (Each row represents one outcome.) Choose all answers that apply: Choose all answers that apply: The landform pictured above is _____, which has formed out of _____ and _____.O A. a glacier, snow; iceB. a glacier; ocean water, snowO C. a mountain; snow; iceOD. an iceberg; ocean water, snow Help asap!!! GIVING BRAINLIST cual es la actitud de las personas de ua comunidad del mundo hispanoblante que te sea familiar con respecto a las personas que se visten de una forma diferente? Black codes definition in relation to the federal government -7 2/3+(-5 1/2) +8 3/4 sorry I'm to stupid to figure this out