Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron
Answer:
Oxygen
Explanation:
-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.
-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.
What is the relationship between Distance and average number of species?
Answer: The relationship between species and distance is that more distance or space has more species and less space has less species.
Explanation:
It can easily be understood by taking the example of the island in such a way that the larger islands contains more species than smaller islands.
There are a diversity of species seen in a bigger islands, more in number and more in variety.
It is very important for the studying the various species and its conservation, protection and other factors.
So, more is the distance , more will be the number of species.
Which best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.
It is oxygen rich
What do you mean by arteries?
The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.
What is oxygenated blood?
Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.
To learn more about arteries here
https://brainly.com/question/3306673
#SPJ2
If there will be changes on trophic levels, what will be the effects on the ecosystem?
Answer:
It can significantly alter the homeostasis of the ecosystem
Explanation:
The trophic level is the position that occupies a given organism/ population/species in the food web. In a food web, the trophic levels are organized into a first category (formed by primary producers, e.g., plants), a second level (primary consumers, e.g., herbivores), and subsequent categories (predators, e.g., carnivores). The abrupt change in the number of organisms belonging to the same trophic level generally has a negative effect on the ecosystem by modifying the trophic structure of communities. For example, decreasing the number of producers will produce a decrease in the number of primary consumers, thereby altering the homeostasis (equilibrium) of the entire ecosystem. On some occasions, it may eventually lead to the extinction of populations and species.
Giving points and brainliest to the first person
I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.
What is true about the water sample?
Choose 1 answer:
(Choice A)
A
It is basic.
(Choice B)
B
It is acidic.
(Choice C)
C
It is neutral.
(Choice D)
D
It is both basic and acidic.
Answer:
it is Basic brooooooo. No B NOT C AND NOT D. oNly A
The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)
Which of the following describes a negative feedback loop?
Answer:
Which of the following describes a negative feedback loop?
Explanation:
where is option ?
Choose all the right answers. Which items are common features of most mammals? produce milk come in all sizes fertilized egg develops inside the body have fins eggs laid outside of body have scales some mammals live in water all have hair or fur
Answer: Some mammals live in water all have hair or fur.
Explanation:
In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen
Answer:
Due to less concentration of carbondioxide gas.
Explanation:
Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.
What is the definition of "earth overshoot day?"
Answer: Earth Overshoot Day is the calculated illustrative calendar date on which humanity's resource consumption for the year exceeds Earth’s capacity to regenerate those resources that year. The term "overshoot" represents the level by which human population overshoots the sustainable amount of resources on Earth.
In Labrador retrievers, the allele for black coat color (B) is dominant to the allele for brown coat color (b). However, if a lab has two copies of the recessive allele for a pigment-depositing gene (e), it can only have yellow coat color. In a cross of two doubly heterozygous black labs (BbEe x BbEe), what fraction of the next generation would one expect to be yellow
Answer:
4/16 or 1/4
Explanation:
This question involves two genes; one coding for coat color and the other for pigment color. The allele for black coat color (B) is dominant to the allele for brown coat color (b) while two copies of the recessive allele for a pigment-depositing gene (e) can only have yellow coat color.
In a cross between two heterozygotes (BbEe), the following gametes will be produced by each parent: BE, Be, bE and be. Using these gametes in a punnet square (see attached image), the fraction of the next generation (F2) expected to be yellow i.e. have the genotype (__ee) will be 4/16 or 1/4.
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
What are chromosomes? How are they different between prokaryotes and eukaryotes?
Answer: A chromosome is a long DNA molecule with part or all of the genetic material of an organism. The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not
Explanation:
Chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
Chromosome:
It is a long thread of DNA molecule as a part of genetic material of all living organisms.
In prokaryotes, DNA is not very much compacted.Only one chromosome is usually scene in prokaryotes.In Eukaryotes, Chromosome are very compacted and form an special structure.Multiple chromosomes are found in Eukaryotes.
Therefore, chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
To know more about Chromosomes,
https://brainly.com/question/296477
1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?
Answer: 1. The nitrogen cycle is a biogeochemical cycle.
2. The carbon cycle is a biogeochemical cycle.
Explanation:
1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.
2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.
PLEASE HELP IM GIVING 50 POINTS FOR THIS!!!!!!!! ALSO BRAINLIEST
Plan a controlled experiment that uses the simulation to investigate how changing the mass of an object changes its acceleration. The net force on the object must stay the same. Record your plan here.
It is possible to measure how acceleration changes with mass by throwing objects with different mass from the same height and measuring the acceleration.
What are the important factors for the experiment?This experiment requires you to measure how acceleration changes if the mass changes. This implies you need to consider the following factors:
Acceleration: This factor is the one you will measure in your experiment.
Mass: This factor is the one you will need to control, this implies using objects from different masses and comparing if mas has any effect on acceleration.
Other: Net force, wind, etc. are other factors that need to be constant to prevent them affect the results.
Steps for the experiment:
Choose a specific heigh: One of the ways of measuring acceleration is to throw objects and determine the acceleration as they fall, so the first step will be to establish a height.
Throw different objects with different masses: You can begin with light objects and move into heavier objects.
Measure acceleration: Every time you throw an object, measure acceleration using the formula A = change in velocity/ time.
Learn more about acceleration in:
brainly.com/question/12134554
#SPJ1
once, more than once, or not once, more than once, or not at all.
This group of questions refers to molecules of the following substances.
(A) Cytochrome
(B) FADH
(C) NAD
(D) NADP
(E) Oxygen (02)
Answer:
a
Explanation:
Two molecules of ATP are generated for every one molecule of glucose in ... a cell needs more NADPH than it does ribose 5-phosphate. ... Practice: Which one of the following is NOT a potential fate of pyruvate ? a.
explain the process of DNA extraction and gel electrophoresis
Answer:
The process of that same framework in question is defined below.
Explanation:
The DNA was indeed prepared by mixing with either a dye as well as a radioisotope which enables the gel to have been recognized. The specific filaments would then be differentiated from one another DNA electrophoresis. The procedure occurs with the injection including its completely separate genetic code into boreholes that have already been reduced either at the final moment including its gel pavement.
how is cancer cell division different from regular cell division
The baker mixed yeast in the dough and kept it away for the night , The next morning it had risen high up , Explain how this happened
Explanation:
Maybe this can help.
In bread making (or special yeasted cakes), the yeast organisms expel carbon dioxide as they feed off of sugars. As the dough rises and proofs, carbon dioxide is formed; this is why the dough volume increases.
**anatomy & physiology question**
if you are at a 60X magnification and the field diameter is 3.2mm an object that's about 1/4th the size of the field diameter what is the size of the object?
Answer:
0.8mm.
Explanation:
If the size of an object is about 1/4th the size of the field diameter so the size of an object is 0.8mm because the fourth part of field diameter is equals to 0.8mm. Due to knowing field diameter of microscope we can calculate the real size of objects that is too small which can't be seen with the naked eye. So one fourth part of field diameter is equal to 0.8mm.
The rate at which a stars burns its fuel (gas) is based on the star's
Mass
Volume
Shape
Color
Answer:
based on the mass of the star
Butanol was used in the production of:
O Cordite
O Nitroglycerin
O Fizzy beverages
Synthetic rubber
Answer:
Synthetic rubber.
Explanation:
Polymerization can be defined as a type of chemical reaction in which molecules that are relatively small in size chemically combine to form a huge chain of molecules.
Simply stated, polymerization refers to a chemical reaction where two or more smaller molecules react to produce larger molecules of the same network or repetitive structural units.
In polymerization, the relatively small molecules are generally referred to as monomers while the larger molecules they produce are known as polymers.
Butanol was used in the production of synthetic (artificial) rubber through a fermentation process.
How can the arrangement of atoms help explain how the white phosphorus and red phosphorus can both be pure phosphorus substances?
Answer:Phosphorus is a chemical element with symbol P and atomic number 15. A multivalent nonmetal of the nitrogen group, phosphorus as a mineral is almost always present in its maximally oxidized state, as inorganic phosphate.
Explanation:
Chemical element phosphorus has the atomic number 15 and the letter P in its symbol. Phosphorus, a multivalent nonmetal belonging to the nitrogen group, is generally always found in the form of inorganic phosphate, which is phosphorus in its maximally oxidized state.
What is phosphorus?The mineral phosphorus, which is also available as a supplement, is naturally present in many foods. It serves the body in a multitude of capacities. It is a crucial component of cell membranes, bone, and teeth. It maintains a healthy range of blood pH and aids in the activation of enzymes.
All tissues and cells must have phosphorus for growth, maintenance, and repair as well as for the creation of DNA and RNA, the genetic building blocks. The balance and usage of other vitamins and minerals, including vitamin D, iodine, magnesium, and zinc, depend on phosphorus as well.
Thus, Chemical element phosphorus has the atomic number 15.
For more information about phosphorus, click here:
https://brainly.com/question/4622631
#SPJ2
The Drosophila genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectively. Of 1000 progeny, 7 are double crossovers. What is the degree of interference
Answer:
The coefficient of interference, I, is 0.1 (10% expressed as a percent)
Explanation:
Available data:
genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectivelyOf 1000 progeny, 7 are double crossovers.The coefficient of interference, I, is complementary with CC.
I = 1 - CC
To calculate the coefficient of coincidence, CC, we must use the next formula:
CC= observed double recombinant frequency/expected double recombinant frequency
Note:
observed double recombinant frequency=total number of observed double recombinant individuals/total number of individuals expected double recombinant frequency: recombination frequency in region I x recombination frequency in region II.By knowing the positions of genes, we can estimate the distances in MU between them per region.
The distance between w and ct genes is 15 - 2 = 13 MUThe distance between ct and t genes is 21 - 15 = 6 MUNow that we know the distances, we can estimate the recombination frequencies by dividing each distance by 100.
recombination frequency of w-ct region = 13MU / 100 = 0.13recombination frequency of ct-t region = 6MU / 100 = 0.06Now that we know the recombination frequencies in each region, we can calculate the expected double recombinant frequency, EDRF, like this:
EDRF = recombination frequency in region I x recombination frequency in region II.
EDRF = 0.13 x 0.06 = 0.0078
Now, by knowing the total number of individuals in the progeny (1000) and the number of double crossovers (7), we can calculate the observed double recombinant frequency, ODRF:
ODRF = number of double crossovers / total number of individuals
ODRF = 7/1000 = 0.007
Finally, with the values of EDRF and ODRF, we can calculate the coefficient of coincidence, CC.
CC = ODRF/EDRF
CC = 0.007 / 0.0078
CC = 0.9
And by knowing the CC we can also get the coefficient of interference, I.
I = 1 - CC
I = 1 - 0.9
I = 0.1 = 10% (expressed as a percent)
Classical biotechnology begins around 1800,
O True
False
Answer:
True
Explanation:
Which relationship is an example of commensalim?
Neurons are either classified by their structural differences or their ? differences.
When does gamete production occur?
Answer quickly please
How do roundworms differ from earthworms?
A. They have a cylindrical body.
B. They have a body that is tapered at both ends.
C. They reproduce sexually.
D. They are not divided into segments.
Answer:
Key difference: Earthworms, Tapeworms and Roundworms are long and cylindrical shaped worms. The basic difference between them is that Earthworms are segmented invertebrates belonging to the phylum Annelida, Tapeworms are flatworms belonging to the phylum Platyhelminthes, and Roundworms are parasitic worms belonging to the phylum Nematoda.
Explanation:
So: A?
Answer:
A
Explanation:
They have a cylindrical body.
Have a great day and good luck
A farmer has been trying to increase his crop yield for the last 10 years by
adding about 25% more fertilizer to his crops than he needs. What will most
likely result from this action?
Select one:
a. Increased crop yields.
b. Air pollution from the excess fertilizers
c. Soil degradation form the excess fertilizers
d. The additional fertilizer will have little to no impact.
Answer:
The correct answer is - b. Air pollution from the excess fertilizers
Explanation:
In long term using excess amount of fertilizer than requirement will lead to several condition such a soil acidity, soil degradation, soil leacing, eutrophication of waterways and many but more improtant is green house gases and air pollution.
Using the excess amount of fertilizer does not help in increasing crop yield but gives negative impact. Using fertilizer more than requirement wil lead to release of toxic and harmful gases in atomosphere and fuming.
