When looking at the cell membrane, where are the lipid heads located?

Answers

Answer 1

Answer:

The cell membrane consists of two adjacent layers of phospholipids, which form a bilayer. The fatty acid tails of phospholipids face inside, away from water, whereas the phosphate heads face the outward aqueous side.

Answer 2

The cell membrane consists of two adjacent layers of phospholipids, which form a bilayer. The fatty acid tails of phospholipids face inside, away from water, whereas the phosphate heads face the outward aqueous side.

What is cell membrane?

The cell membrane is a biological membrane that separates and protects the interior of all cells from the outside environment.

Moreover, the cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.

Hence, cellular membranes — including plasma membranes and internal membranes — are made of glycerophospholipids, molecules composed of glycerol, a phosphate group, and two fatty acid chains.

Learn more about cell membrane:

https://brainly.com/question/13524386

#SPJ2


Related Questions

according to this time table a train --------- at 3 o'clock .A will leave .B is leaving C. is going to ​

Answers

i’ll call him when you come over lol eueywuwuwyeyeoooqo is there anything you need me and i

Answer:

is going on is your answer

Gizmos ( Building DNA )
Activity A :
Question : What is the structure of DNA
Build : follow the steps given in the gizmo to construct a molecule of dna

Answers

Answer:

Double Helical Spiral structure

Explanation:

DNA is a helical spiral structure in which two long strands of nucleotide form a double helix structure.

It looks like a structure of ladder in which the phosphate and sugar molecules from the side of the ladder and the base pairs form the rungs.

what are alleles mutations in the dna

Answers

Answer:

Mutations Are Recessive or Dominant

Someone pls help me ill give out brainliest pls don’t answer if you don’t know

Answers

im pretty sure its 354.6 hope this helps

Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3

Answers

Answer and Explanation:

La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.

Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.

El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.

ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3

Codones   ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT

ARNm ⇒  UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA

Codones  UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.

Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.

AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU

La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.

UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

TYR  SER  TRP  VAL   Stop  THR  ARG  ILE  ARG  PHE  PHE  Stop

2. Ang
ay isang genre na gumagamit ng mahika at
iba pang supernatural na penomena bilang punong elemento
ng plota, tema, at/o ganapan.
A. Pabula B. Drama
C. Pantasya D. Mga Tula​

Answers

Answer:

C. Pantasya

Explanation:

Ang anumang genre ng pantasya ay magkakaroon ng isang uri ng supernatural o magic na tema na isinama dito

Sana nakatulong ito :)

How to overcome Confusion?????​

Answers

Answer:

use a full heal

Explanation:

EARTH SCIENCE CLASS
Why is the street (asphalt) hotter than the sidewalk in the summer ?

Answers

Answer:

bad albedo ? sorry if not right

How many acres of land do you think were required for all forms of food except
beef?
A. 20,475 acres
B. 45,510 acres
C. 105,000 acres
D. 410,505 acres

Answers

The answer would be 105,000

Which of the following organelles is properly matched to it's function?


lysosome: storage

endoplasmic reticulum: movement

lysosome: digestion

chloroplast: making proteins

Answers

The organelle properly matched to it's function is

-(C) lysosome: digestion

Explanation:

Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies

Endoplasmic reticulum : to produce proteins for the rest of the cell to function.

Chloroplast : They are responsible to carry out photosynthesis

which scenario is an example of the transfer of thermal energy by conduction?

Answers

Answer:

heat causes winds to blow from the water to the land. Heated air molecules in a hot air balloon soon carried thermal energy to the top of the balloon. this is an example of conduction.

Explanation:

Have a nice day :)

Photosynthesis in plants is an example of​

Answers

Answer: If you are asking if your answer is correct, it is. Photosynthesis is the process of converting sunlight into food and energy, therefore it is an example of nutrition.

Photosynthesis in plants is an example of nutrition

What is photosynthesis?

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.

It is carried out by algae, plants and even some microorganisms.

The sugar produced form photosynthesis is a great source of nutrients for photosynthetic organisms and plants.

Therefore, photosynthesis in plants is an example of nutrition

Learn more about photosynthesis here:

https://brainly.com/question/3529377

#SPJ9

SOMEONE HELP WILL GIVE BRAINLIEST ANSWER

Which of the following suggests what happens when a mutation occurs in an organism? Select one:
Genes begin to appear in different individuals of the population all at once.
The organism develops new traits as a result of using a particular body part.
New traits appear from changes in the instructions given to the cell by the DNA. Useless traits are removed from the organism due to the loss of nucleotides​

Answers

Answer:

New traits appear from changes to the DNA..

Explanation:

A mutation is when DNA is changed or altered in some way, causing it to tell the cells to do something different from what they usually do such as growing a body part a certain way, or making skin regenerate a certain way. some mutations are specific to one individual person or thing, other mutations are passed down through generations and become a new normal for the species. new diseases such as viruses are often caused by the virus mutating...this is how we have so many different strains of the flu...

The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole

Answers

I am pretty sure it’s D) Near Earth’s South Pole, I’m so sorry it’s it’s wrong

A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia

Answers

Answer:

The correct option is 2 Nephrogenic diabetes insipidus.

Explanation:

Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.

As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.

Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.

Therefore, the correct option is 2 Nephrogenic diabetes insipidus.

That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.

What is the smallest LIVING part of an organism?

A. Molecules

B. Cells

Answers

Answer:

Hi, there the answer is a cell

Explanation:

The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

Answer:

B. Cells

Explanation:

The cells are the smallest living part of an organism.

Te
а.
Which of the following is a way that scientific advancements have benefited society?
increased energy efficiency
Б. increased resource use
increased urbanization
d changes in the global climate
C.
Please select the best answer from the choices provided
Mark this and return
Save and Exit
Next
Submit

Answers

Answer:

Б. increased resource use

increased urbanization

if humans began hunting and driving the great barracuda to extinction how would this affect the ecosystem (answer should discuss biodiversity, food webs, and food chains)

Answers

Answer:

Generally considered to be the tertiary consumers (top level of the food pyrmaid), barracuda feed on an array of preys including grunts, groupers, snappers, small tunas, mullets, killifishes, herrings, and anchovies. By feeding on these marine organisms, barracuda prevent them from increasing in number.

Now let's barracuda's number starts decreasing due to hunting and other reasons. This will result in other primary and secondary consumers to increase in population. An increase in the number of primary and secondary consumers in the food chain will result in a decreasing number of plants, i.e. the number of producers decreases. Hence, this will negatively affect other connected food chains in the marine food web.

Explanation:

what do you mean by faunal Diversity

Answers

Answer:

animal life especially

Explanation:

i hope it helps

this is my answer

correct me if im wrong

#carryonlearning

Classify each of the samples in the grid below as one of the following substances. Each one may be used more than once:

Answers

si 0?no Nop suficientemente silvestre usuario independencia 6t?

Bacteria and fungi fulfill which role in an ecosystem?
A. Consumer

B. Decomposer

D. Producer

Answers

Answer:

B. Decomposer

Explanation:

Bacteria and fungi fulfill the role of decomposers in an ecosystem. Hence, option (B) is the correct answer.

which sequence demonstrates the increasing complexity of levels of organization in multuticelluar organisms ?

A organelle_cell_tissue_organ_organ system_oraganism

B cell_organelle_tissue_organ_organsystem organisms

C organelle_tissue_cell_organ_organ system organisms

D cell_organism _organ_organ system _tissue_organelle

Answers

Answer:

it's A

Explanation:

It's just a simple chain. Many Organelles form cell, many cells form a tissue, many tissues together form an organ, various organs together form an organ system and different organ systems together make a complete organism.

I hope it helps :))

Cellular respiration is how living things obtain energy for life. The organelle where cellular respiration takes place is the

A. chloroplast

B. Golgi body

C. mitochondria

Answers

Answer:

C. Mitochondria

Explanation:

Yes mitochondria is correct

what is a good definition of photosynthesis?
A. using glucose to create light

B. putting together lights so we can see

C. using light to put together food (glucose)

Answers

Answer:

The best answer is C

Explanation:

Plants use light  to create their own food. this is called  photosynthesis

Answer:

C

Explanation:

The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.

How are the early stages of embryonic development different from the later stages of development?

Answers

The early stages of embryonic development begin with fertilization. The process of fertilization is tightly controlled to ensure that only one sperm fuses with one egg. After fertilization, the zygote undergoes cleavage to form the blastula

Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.

Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.

Answers

Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase

Explanation: I got it right hopefully it helps

Answer:just did it

Explanation:

Ivy grows specifically on stone walls, what type of response is this?
A. Hydrotropism

B. Thigmotropism

C. Phototropism

D. Geotropism

Answers

Answer:

B. Thigmotropism

Explanation:

Thigmotropism is a directional growth movement which occurs as a mechanosensory response to a touch stimulus. Thigmotropism is typically found in twining plants and tendrils, however plant biologists have also found thigmotropic responses in flowering plants and fungi.

Answer:

B. Thigmotropism

Explanation:

The ivy grows specifically on stone walls, it shows Thigmotropism.

IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE

Answers

Yup it is correct

Hope u get good marks stay safe
:D

How do I calculate Ph?

Answers

Explanation:

To calculate the pH of an aqueous solution you need to know the concentration of the hydronium ion in moles per liter (molarity). The pH is then calculated using the expression: pH = - log [H3O+].

which process reduces the number of chromosomes by half

Answers

Answer:

Meiosis process reduces the number of chromosomes by half.

Explanation:

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.

Answer:

meiosis

Explanation:

meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells

Other Questions
In a two-digit number, the units digit is twice the tens digit. If the number is doubledit will be 9 more than the number reversed. Find the number. some machine/items/gadget having only hardware Which things need to be present for natural selection to take place? (select all that apply)A.Variation in the population.B.The ability for asexual reproduction.C. Competition between organisms.D. Large amounts of resources. can u help me part 3.. what is the tension that runs throughout the entire story of notes of a Native Sonwhat is the tension what is the tension that runs throughout the entire story Which equation represents a circle with a center at (3, 5) and a radius of 6 units? as a result of the invention of the _____, the whole world became excited about _____ Which sentence about an ocean current is correct how is life on earth so important? An individual has $30,000 invested in a stock with a beta of 0.7 and another $70,000 invested in a stock with a beta of 1.2. If these are the only two investments in her portfolio, what is her portfolio's beta? Round your answer to two decimal places. Your cell phone plan costs 55 dollars a month, plus 35 cents per minute. Write an equation to represent the monthly bill of the cell phone plan. Find an equation for the line that passes through the points (-2,-6) and (6,4). HELPPP PLEASE!!!!!!!!!! what will happen to satellite if the linear speed is reduced?. give a reason for your answer Which of the following best explains the role that domination of Asian trade routes in the north and multiple seaports in the east,west,and south had on the Indian subcontinent Question 2: Which word is PARALLEL to the word CALM? *O helpedrehearseconfident Please help me with this discussion assignment. I been posting it multiple times hopping for an answer. Its an urgent assignment. Help asap!Give some thought to the changes that the Spanish brought to California. Think about the effect the Spanish had on Modern California/California today Which equation is equivalent toy-1= 5(x+2) ? Change the units up above to the correct answer from (a) to (d) What happened to West Coast Japanese-Americans, during the war?