Where is the element coded in a web page.

Answers

Answer 1

Answer: Developer tools

Explanation:

To find and view code in a webpage it's often in the developer tools section for most web browsers. Like for Google Chrome click on the 2 dots than more tools than developers tools to enter the console. Then click elements to display a webpage's code. Hope this helps!


Related Questions

Do you think GE will become one of the top 10 U.S. software companies? Why or why not?

Answers

Answer: I do belive GE will be one of the top 10 software companies because each year the software side of GE is growing 20 perecnt per year which is a big deal!

Explanation:

There are different kinds of firms. I think GE will become one of the top 10 U.S. software companies. The world is gradually turning to the production of electric cars and much more appliances and with this, I believe they would grow to the top 10 in no time.

General Electric Company (GE) is known to be one of the top American multinational conglomerate that is seen in New York State.

It has its headquartered in Boston and thy have been ranked 33rd in the 2020 ranking, among the Fortune 500 in the United States using their gross revenue.

Learn more about General Electric Company from

https://brainly.com/question/26379157

high level languages are closer to machine language than humans yes or no​

Answers

they are closer to human languages and further from machine so, no.

Answer:

yes

Explanation:

because they were built from humans

ong answer, but make sure to provi
you
reasoning
Sales Company:
W.D. Widgets is a small company that sells widgets. They're mostly made up of salespeople who work with lots of clients.
You've taken over as the sole IT person for this company of 80-100 people.
R teils you to provision a machine for a new employee, you order the hardware directly from a business vendor.
You keep one or two machines in stock, in case of emergency. The users receive a username that you generate for them.
You then give them an orientation on how to login when they start. You currently manage all of your machines using
Windows Active Directory. The company uses only Windows computers. When a new computer is provisioned, you have
to nistallots of sales-specific applications manually onto every machine. This takes a few hours of your time for each
15
machine. When someone has an IT-related request, they email you directly to help them.
Almost all software is kept in-house, meaning that you're responsible for the email server, local machine software, and
instant messenger. None of the company's services are kept on the cloud.
Customer data is stored on a single file server. When a new salesperson starts, you also map this file server onto their
local machine, so that they can access it like a directory. Whoever creates a folder on this server owns that folder and
everything in it. There are no backups to this critical customer data. If a user deletes something, it may be lost for
everyone.

Answers

Answer:

Umm just go what your gut tells you to do

Explanation:

Asymmetric encryption uses only 1 key.

A)
False

B)
True

Answers

A.) false

Symmetric encryption uses a single key that needs to be shared among the people who need to receive the message while asymmetric encryption uses a pair of public key and a private key to encrypt and decrypt messages when communicating.
A) false is the answer

write passage on computer virus​

Answers

In more technical terms, a computer virus is a type of malicious code or program written to alter the way a computer operates and is designed to spread from one computer to another. A virus operates by inserting or attaching itself to a legitimate program or document that supports macros in order to execute its code.

Answer:

A computer virus is a relatively small program that attaches itself to data and program files before it delivers its malicious act. There are many distinct types of viruses and each one has a unique characteristic. Viruses are broken up into to main classes, file infectors and system or boot-record infectors.

hope it helps

How many fnaf games did Scott Cawthon make?

Answers

Answer:

8 but he is making FNaF security breach

Explanation:

there is FNaF VR help wanted

Answer:

8 or 10

Explanation:

To prevent long page load times for pages containing images, it is best to use a compressed file format such as JPG, as well as appropriate image dimensions and
resolution.
magnification.
orientation.
colors.

Answers

Answer:

The answer to this question is given below in the explanation section.

Explanation:

The given options to this question are:

resolution. magnification. orientation. colors.

The correct option to this question is 1. i.e.

Resolution.

The resolution of an image determines how many pixels per inch an image contains. Image having a higher resolution takes long page load times for a page and lower resolution takes less page load time. So, to prevent long page load times for pages containing images, it is best to use compressed file formation as well as appropriate image dimension and resolution.

While other options are not correct because:

Magnification, orientation, and color does not affect the page load time. Page load time for images only affected by the dimension and resolution of the images.

Answer:

B C E

A web page is taking too long to load. It contains only a small amount of text and two images. Choose all items that represent possible causes.

large font size

images do not use a compressed format like JPG

image resolution too high

image resolution too low

image dimensions too large

Internet Explorer inserts the Flash Shockwave Player as a(n) ____ control. Group of answer choices AVI ActiveX Class Quicktime

Answers

Answer:

Internet Explorer inserts the Flash Shockwave Player as a(n) ____ control.

ActiveX

Explanation:

ActiveX controls are small apps, also called “add-ons,” that allow websites to provide content such as videos and games. They also enable web interaction, make browsing more enjoyable, and allow animation. However, these ActiveX controls can sometimes malfunction, produce unwanted contents, or install spyware in your system because they exercise the same level of control as the computer user.

To prevent long page load times for pages containing images, it is best to use a compressed file format such as JPG, as well as appropriate image dimensions and
resolution.
magnification.
orientation.
colors.

Answers

Answer:

The answer to this question is given below in the explanation section.

Explanation:

The given options to this question are:

resolution. magnification. orientation. colors.

The correct option to this question is 1. i.e.

Resolution.

The resolution of an image determines how many pixels per inch an image contains. Image having a higher resolution takes long page load times for a page and lower resolution takes less page load time. So, to prevent long page load times for pages containing images, it is best to use compressed file formation as well as appropriate image dimension and resolution.

While other options are not correct because:

Magnification, orientation, and color does not affect the page load time. Page load time for images only affected by the dimension and resolution of the images.

list any three importance of computer​

Answers

Answer:

here is the answer

Explanation:

1) accurate

2) fast

3) can accomplish tasks more effencily

g 'write a function that takes as input a list and outs a new list containing all elements from the input

Answers

Answer:

def mylist(*args):

   return args

new_list = mylist(2,3,4,5)

Explanation:

The simple python code above defines a function called mylist that receives multiple length of element as a list and returns the list a new list. The "*args" allows the function to receive any number of item and converts them to a list that is returned in the next statement.

The can also be achieved by simply assigning a squared bracket enclosed list to the variable or with the list() constructor.

A free-frame list Select one: a. is a set of all frames that are used for stack and heap memory. b. is a set of all frames that are currently unallocated to any process. c. is a set of all frames that are filled with all zeros. d. is a set of all frames that are currently being shared by at least two processes.

Answers

Answer:

b. is a set of all frames that are currently unallocated to any process

Explanation:

The free frame list is the list that used for all kind of the frames that presently non-allocated to any kind or process

Therefore as per the given situation, the correct option is b as it fits to the current situation

Hence, all the other options are wrong

So, only option b is correct

The same is to be considered

Answer:

b. is a set of all frames that are currently unallocated to any process.

Write a static method that takes a String and returns an integer. Return the number of characters in the passed in, String parameter.

Answers

Answer:

Explanation:

The following code is written in the Java programming language. It is a function called howBig that takes in a String as a parameter and returns an int. The function grabs the string and then detects the size of the String (number of Characters it has) and then places that number into an Integer variable called wordSize. Then it returns the variable wordSize.

public static int howBig (String myWord) {

       int wordSize = myWord.length();

       return wordSize;

   }

Following are the Program to the given question:

Program Explanation:

Defining a class "Main".Inside a class, a method "Length" is defined that takes string variable "s" as the parameter.Inside the method,  a conditional statement is defined that checks length of the string value and prints its value.In the next step, the main method is declared that calls the length method, and print its return value.

Program:

public class Main //defining a class Main  

{

   public static int Length(String s)//defining a method getLength that takes String parameters

   {

       if(s==null)//defining if block that check s parameter value equal to null

       {

           return 0;//return 0

       }

       else //defining else block

       {

           return s.length();//using return keyword that return length of String

       }

   }

   public static void main(String[] args) //defining a main method

   {

       System.out.println(Length(null));//calling method and print its value

       System.out.println(Length("abcd"));//calling method and print its value

   }

}

Output:

Please find the attached file.

Learn more:

brainly.com/question/19737952

What kind of number is 36A

Answers

Rational
or compound what form are you looking for?

Which of the following examples requires a citation in a paper you're writing?
A. General information you already knew but want to clarify or conform
B. The table of contents
C. A paraphrasing of your original work in a different section of your paper
D. A direct quotation that is marked off by quotation marks

Answers

Answer:

D. A direct quotation that is marked off by quotation marks

Explanation:

Quotation marks are responsible for indicating that some texts are explicitly referenced in a paper with no changes made. This type of quote must be very well referenced in the paper, both on lines where the quotes are written with author's surname, date of publishing, page referenced, and also on the bibliography at the end of the paper with all these references very well detailed, including text's title, translators (if any), number of editions, publishing house, and more. It is important to highlight it depends on the policies of publishing the paper must follow because there are different patterns for referencing and quoting.

which two pieces of information must be provided when saving a file for the first time in wordpad​

Answers

The name and the saving location.

Write a test program that prompts the user to enter a two dimensional array and displays the location of the smallest element in the array.

Answers

Answer:

def element_loc():

   is_end = 'n'

   dimen2 = []

   while is_end == 'n':

       par1 = input("Enter rows and columns: ").split(",")

       part = [int(i) for i in par1]

       dimen2. append(part)

       is_end = input("Do you want to add more rows? y/n: ")

   mini = list()

   for i in dimen2:

       mini. append(min(i))

   result = min(mini)

   row_index = mini. index(result)

   col_index = dimen2[row_index]. index(result)

   print("Row: ", row_index, "Col_index: ", col_index)

element_loc()

Explanation:

The python program solution above prompts users for the two-dimensional array and then the rows of the array are compared with the minimum value stored in another list or array. The row index and the column index are gotten from the mini and dimen2 arrays respectively and are displayed as the position of the minimum value in the two-dimensional array.

Code used when creating a hyperlink to a specific part of the same page.

Answers

Answer:

Give The Object Or Text You'd Like To Link To A Name.

Take That Name That You've Chosen, And  Then Now Insert It To An Opening HTML Anchor Link Tag.

Place That Complete Opening <a> Tag From Before The Text Or Object You Want To Link It To, Then Now Add A Closing </a> tag after.

(Hope this is correct and hope this helped. Sorry if I'm wrong and you get this wrong)

Many electronic devices use a(n) ?, which contains all the circuit parts in a miniature form.

Answers

Answer:

An integrated circuit is a single, miniature circuit with many electronically connected components etched onto a small piece of silicon or some other semiconductive material. (A semiconductor is a nonmetallic material that can conduct an electric current, but does so rather poorly.)

Explanation:

Many electronic devices use a(n) integrated circuit which contains all the circuit parts in a miniature form.

The use of  integrated circuit is known to be a kind of a single, miniature circuit that has a lot of electronically connected parts that are designed onto a small piece of silicon or semi conductive material.

A lot of electronic components are known to be capacitors, inductors, resistors, diodes, transistors and others.

Learn more about electronic devices from

https://brainly.com/question/11314884

A switch is a device that connects multiple computers into a network in which multiple communications links can be in operation simultaneously. True False

Answers

Answer:

True

Explanation:

A network switch is also called switching hub or a bridging hub. It is a device that connects multiple computers into a network in which multiple communications links can be in operation simultaneously. It makes use of Mac addresses in the forwarding of the data link layer (layer 2) of the OSI model. Types include managed switches, unmanaged switches, smart switches but to mention a few.

If you have 128 oranges all the same size, color, and weight except one orange is heavier than the rest. Write down a C++ Code/Algorithm to search the heavy orange, in how many steps would you be able to find it out?

Answers

Answer:

#include <iostream>

using namespace std;

void Search_heavy_orange(int arr[], int l, int r, int x)

{

int count = 0, m = 0;

while (l <= r) {

 m = l + (r - l) / 2;

 // Check if x is present at mid

 if (arr[m] == x) {

  count++;

 }

 // If x greater, ignore left half

 if (arr[m] < x) {

  l = m + 1;

  count++;

   

 }

 

 // If x is smaller, ignore right half

 else {

  r = m - 1;

  count++;

 }

}

cout << "............For Worst Case......." << endl;

cout << "Orange with heavy weight is present at index " << m << endl;

cout << "Total number of step performed : " << count << endl;

}

int main()

{

// Assuming each orange is 100 gm and the weight of heavy

// orange is 150 gm

int orange_weight[128];

for (int i = 0; i < 127; i++) {

 orange_weight[i] = 100;

}

// At worst case the heavy orange should be at last position

// inside the basket : 127

orange_weight[127] = 150;

// We will pass array , start index , last index and the search element

// as the parameters in the function Search_heavy_orange

Search_heavy_orange(orange_weight, 0, 127, 150);

return 0;

}

Explanation:

Question #3
Multiple Choice
Which statement is true?
O A collection is a type of deque.
O A list is a type of deque.
O A deque is a type of list.
O Adeque is a type of collection.

Answers

A deque is a type of list

Answer:

D. A deque i a type of collection

Explanation:

I do computer science too ;3

Documenting findings, actions, and outcomes of network troubleshooting calls is an essential part of the troubleshooting process. List the reasons why documentation is critical, and discuss the form that this documentation could take (e.g. blogs, wikis, professional document management software, etc). Include a detailed description of what information would need to be saved.

Answers

Answer:

The main purpose of documentation is for future reference on the cost, materials, procedures, and techniques used in a task. It can be in form of a video log, report, digital text document or software, etc.  

Explanation:

Documentation is an important practice of taking notes of events during a process. It could in the process of creating or discovering new ideas or repair or management of existing processes. It holds the time, cost, technique, event name, measures-taken, etc, that would totally describe the event.

Where the heck is the leader board?

Answers

Good question I’m wondering as well

I HAVE NO IDEA WHERE THE LEADERBOARD IS #### #### #### #### #### ####.

A backup can be installed that costs​ $100. What is the minimum allowable reliability for the backup that would make installing it​ worthwhile? The minimum allowable reliabilit​ = nothing​%

Answers

Answer:

0.95

Explanation:

Reliability is a assurance that a machine would have an efficiency of one or close to one.

The minimum allowable reliability R;

(1 - R) x 2000 = 100

Make R the subject of the formula;

R = 1 - (100/ 2000)

R = 1 - 0.05

= 0.95

You are configuring a firewall to use NAT. In the configuration, you map a private IP address directly to a persistent public IP address. What form of NAT is being used?
A. Registered NAT.B. Static NAT.C. Dynamic NAT.D. Advanced NAT.

Answers

Answer:

Option B (Static NAT) would be the correct choice.

Explanation:

Static NAT seems to be a method of NAT methodology used to navigate as well as monitor internet usage from some kind of specific public IP address to something like a private IP address. Everything always allows the provision of web access to technology, repositories including network equipment inside a protected LAN with an unauthorized IP address.

Some other decisions made aren't relevant to the situation in question. So the above alternative is indeed the right one.

Write an LC-3 assembly language program to read in a two-digit decimal number whose digits add up to less than 10 and display the sum of those digits in the next line.
Sample execution (user input underlined) : Please enter a two-digit decimal number > 27. The sum of the digits = 9

Answers

Answer:

Explanation:

.MODEL SMALL

.STACK 100H

.DATA

   STR1 DB 0AH,0DH, 'THE SUM OF TWO DIGITS PRENT IN THE GIVEN NUMBER'

   FNUM DB ?

   STR2 DB ' AND '

   SNUM DB ?

   STR3 DB ' IS '

   ANS DB ?

   STR4 DB ' $'

.CODE

MAIN PROC

   MOV AX, "at" DATA       PLEASE NOTE: your "at" need to be in symbol

   MOV DS,AX                    It is because this text editor who allow the sub-

                                            mission of this answer if i use the symbol format

   MOV AH,2                       that is why put it in bold and parenthesis

   MOV DL,3FH

   INT 21H

   MOV AH,1

   INT 21H

   MOV BL,AL

   MOV FNUM,AL

   INT 21H

   MOV SNUM,AL

   ADD BL,AL

   SUB BL,30H

   MOV ANS,BL

   MOV AH,9

   LEA DX,STR1  

   INT 21H

   MOV AH,4CH

   INT 21H

   MAIN ENDP

END MAIN

A .cache is made up of _____ , each of which stores a block along with a tag and possibly a valid/dirty bit

Answers

Answer:

Blocks

Explanation:

A .cache is made up of blocks, each of which stores a block along with a tag and possibly a valid/dirty bit.

Basically, each blocks that makes up the cache stores additional block and sometimes a bit.

Define a toString prototype method that returns the cat's name, gender, and age separated by semicolons.

Answers

Answer:

Following are the program to this question:

import java.util.*;//import package for user input

public class Main//defining main class

{

public static String Cat (String name, String gender, int age)//defining string method Cat that accept parameter value

{

return name + ';' + gender + ';' + age;//return parameter value

}

public static void main(String[] args) //defining main method

{

   String name,gender;//defining String variable

   int age;//defining integer variable

   System.out.println("Enter name, gender and age: ");//print message

   Scanner obx=new Scanner(System.in);//creating Scanner class object for user input

   name=obx.next();//input name value

   gender=obx.next();//input gender value

   age=obx.nextInt();// input age value

   System.out.println(Cat(name,gender,age));//print return method value

}

}

Output:

Enter name, gender and age:  

dani

Female

12

dani;Female;12

Explanation:

In the above-given code, a string method Cat is declared, that accepts three variable "name, gender, and age", inside the method return keyword is used that returns the parameter values.

In the main method, the above parameter variable is declared, which is used to input value from the user-end, and used the print method to print its return value.

Gabby needs to perform regular computer maintenance. What should she do? Check all that apply.

Answers

what are the options ???????????

Answer:

all of them but B

Explanation:

Correct on edge

Other Questions
please help meeeeeeeeeeeee Multiple ChoiceWhich method adds an element at the beginning of a deque?appendleftO insertleftO popleftaddleft Which element is probably most like Carbon? and why Examine the map of major North American cities. A map titled Major Cities in North America with labels A, B, C, and D. Canada, the United states, and Mexico are labeled. A is near Washington and Canada. B is near the Pennsylvania and New York. C is in southern California. D is in Mexico. Which city is located at C? Vancouver Los Angeles Guadalajara Washington, DC GIVING BRAINLIEST!!!What were the major issues that prisoners faced in Andersonville prison? Select all that apply. (2 points)A. Water was scarce and polluted.B. Food supplies were inadequate so prisoners starved.C. Prisoners rebelled and staged an uprising.D Prison overcrowding forced prisoners to be freed early. What is the product of 417.2 x 0.64? Helppppppppppppppppppppppppppppppppp!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! what do you mean by community based medical profession simplify by combining like terms: 3 1/9p + 5 - 1/3p How would adding the catalyst nitrogen monoxide (NO) affect this reaction?2SO2(g) + O2(g) 2SO3(g)A) NO increases the rate at which SO3 molecules are formed.B) NO reacts with SO3 to produce more SO2 molecules.C) NO decreases collisions between the SO2 and O2 molecules.D) NO increases the concentration of the SO2 and O2 molecules.E) NO increases the activation energy of the SO2 and O2 molecules. thanks guys i only got one question wrong i cant find my answer. You should really give your people the answer they are looking fo instead of giving sujestions. Write the slope-intercept equation for the graph. Energy that is stored is called... Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC If a girl is standing still and holding a box, is she doing any work? (No)The _____ on the box is not in the same _____ as the movement 9x + 6 4x 1x + 1 10 What is the function of the flower in plant reproduction? disperses seeds captures sunlight protects the stem attracts pollinators write a letter to your friend describing him/her about your country nepalGuys plz help me with this question write a letter about nepal. If u guys help me with this question i will make you brainliest and give 25 points. But its so urgent so plz do it fast. Gregor Mendel observed that pea plant traits did not blend in their offspring?