Which body system produces movement by contracting and relaxing?

Integumentary system
Muscular system
Skeletal system
Synovial joint system

Answers

Answer 1
Synovial joint and muscular system

Related Questions

what is an example of simple sugar

Answers

Answer:

fructoseglucosegalactose

Explanation:

Simple sugars are carbs with one (monosaccharide) or two (disaccharide) sugar molecules.

They are commonly found in nutritious whole fruits, syrups, and honey.

What are the two functions of the nervous system? *
A. Provides stucture and protection
B. Sends and recieves signals throughout the body
C. Obtain nutrients and removes waste produced by the body
D. Regulates body temperature and protects the body from damage


Help please

Answers

Answer:

B. Sends and receives signals throughout the body.

Answer:

sends and receives signals throughout the body

hope it helps

Can someone please correct me or tell me if I’m correct please that will be lovely

Answers

Answer:

A

Explanation:

Destruction of habitat is not going to preserve the habitat.

is it wrong for parents to give female hormone pills to there little sons, without there consent?

Answers

Without consent, almost everything is wrong... so yes, it’s wrong.
Yes definitely nxnbbbb

The stable stage that is established in an area as a result of the process of ecological succession is known as the
A) pioneer organism
B) climax community
C) biotic stage
D) heterotrophic community

Answers

Answer:

Climax community

Explanation:

Answer:

B is your answer

Explanation:

Many paleontologists hypothesize that present-day whales evolved from ancient ancestors that had four legs and walked on land. Evidence for that
hypothesis would be a sequence of whale-like fossils
A. in which the oldest fossils had flipperlike appendages and the most recent fossil had four limbs.
B. in which the oldest fossil had four limbs and the most recent fossil had flipperlike appendages.
C. that indicate that the ancestors of present-day whales were wiped out during a mass extinction.
D. that indicate that whales evolved before animals with four legs.

Answers

Answer:

B

Explanation:

If the oldest fossils showed legs and the more recent ones had only flippers, it would show the change over time.

Teniendo en cuenta problemáticas de la biología o de su aprendizaje ,pensar un tema investigar desde el enfoque cualita tivo y otro desde el enfoque cuantitativo

Answers

Answer:

Caso de estudio: El efecto de estresores ambientales sobre el comportamiento animal

- Ejemplo de un tipo de estudio cualitativo: la influencia de estresores ambientales (por ej. niveles anormales de dióxido de carbono atmosférico) sobre el comportamiento en ratones de laboratorio  

- Ejemplo de un tipo de estudio cuantitativo: la influencia de estresores ambientales sobre los niveles de producción de hormonas asociadas a cambios comportamentales en ratones de laboratorio  

Explanation:

Un enfoque cualitativo se caracteriza por el hecho de que la información obtenida durante dicho estudio se agrupa en categorías mutuamente excluyentes. En biología, los estudios de tipo cualitativo generalmente se caen dentro de la dicotomía observacional (es decir, presencia o ausencia del factor en estudio). En el ejemplo arriba citado, es posible obtener datos relacionados a uno o más determinado aspectos comportamentales en los individuos bajo estudio (por ejemplo, presencia o ausencia de signos de irritabilidad) en ratones sometidos a algún estresor ambiental (por ejemplo, niveles anormales de CO2 atmosférico). Por otra parte, en un enfoque cuantitativo, la información se recopila en intervalos obtenidos a partir de operaciones aritméticas (estadística paramétrica). En el ejemplo, los datos obtenidos pueden ser clasificados en intervalos referidos a los niveles hormonales. Esta información resulta útil para determinar si las diferencias en los niveles hormonales entre individuos que se encuentran en presencia del estresor ambiental son estadísticamente significativas respecto al grupo control (individuos desarrollados en un ambiente con niveles normales de CO2 atmosférico), y de este modo concluir si el estresor ambiental puede o no modificar variables comportamentales. Los estudios cualitativos permiten el uso de variables independientes las cuales son clasificadas como cualitativas (discretas).

Question 9
After 60 days, 100g of a certain element has decayed to only 12.5g.
What is the half-life of this element?
A.) 20 days
B.) 30 days
с.) 8 days
D.)5 days

Answers

30 days I think because I am not so sure

The image depicts the impact of a mutagen on the phenotype of F1 and F2 offspring in nematodes, a common roundworm. Which
arguments can be made based on the information in the model You may select more than one correct choice.

Answers

Answer:

A, D, E

Explanation:

just did it

The arguments that can be made based on the information in the model are as follows:

The mutated DNA is a recessive allele. The mutagen altered the DNA of the worm in the parental generation. The DNA altered by the mutagen occurs in gamete cells and is passed to offspring.

Thus, the correct options for this question are A, D, and E.

What is Mutagen?

Mutagen may be characterized as a type of agent that possesses the capability to induce mutation within the genetic segment of living organisms. Mutagens are of two types, they are:

Physical mutagens: UV radiations.Chemical mutagens: Chemicals like ethidium bromide.

According to the context of this question, mutation can only be inherited from parent to offspring, if it is induced within the gamete cells of parents. While during the course of life, the mutation also induces in the genomic sequence of an individual.

Therefore, the correct options for this question are A, D, and E.

To learn more about Mutation, refer to the link:

https://brainly.com/question/17031191

#SPJ2

hey besties if you would help me with these questions i think i can finally get myself to fully understand and do the rest of the assignment lol (its very late lol and i’m so close to just giving up)

1. explain how body plan and anatomy enables invertebrate to perform essential functions it needs to survive.

2. explain how body plan and anatomy enables chordate to perform essential functions it needs to survive.

3. explain how body plan and anatomy enables primate to perform essential functions it needs to survive.

Answers

Answer:

1)Invertebrates are known as creatures that do not have backbones. Even though these creatures do not have backbones, they have been uniquely designed in order to survive. According to studies, most of these creatures are found in the sea and one of them is the Star Fish or also called as the Sea Star. Starfish's functions and ability to survive is not the same like other animals which make them unique in a different way. The starfish's body is hard and bony for protection purposes and they exist in a variety of colors for camouflage. Their essential functions in order to survive are as follows:

-The Ability to Regenerate: Starfishes have the ability to grow damaged and lost limbs or even their entire body as long as the center part is still present and intact. And this is their way of reproduction as well.

-Having Tube Feet: Its arms are covered with a suction-like tiny cups of tube feet. This unique design of the starfishes enables them to move and secure themselves, especially on rocks and ocean floors.

-Unique Feeding Ability: Sea Stars don't have mouths nor teeth to ingest food. Rather, these creatures have the ability to push open or turn their stomachs out and digest its food. After digestion, their stomachs retract back to their bodies.  

-Vascular System: How starfishes survive does not rely on having hearts, brains and blood. Rather, they use the seawater. The seawater serves as the one the circulates inside the sea stars' bodies and this is when nutrients and oxygen are being transported and absorbed.

2)Keep in mind invertebrates are those who have exoskeletons (outside skeleton) or are hydrostatic (no skeleton). This make up 95% of all animals for example an ant or sponge. For a sponge, all it has is tissues that enable it to allow water to flow out the tops.  

Chordata are anything with vertebrates so a simple fish could suffice. THEY HAVE 4 SPECIFIC CHARACTERISTICS: 1.Notochord 2.Dorsal, hollow nerve cord 3.Pharyngeal slits 4.Muscual, an.al tail  

This is us, we have thumbs, and vertebrates.

3)The bipedalism of primates puts their heads on a higher elevation and this allows them to see predators or prey from afar hence giving them advantage. Opposable thumbs on the hand and feet allow primates to grasp and handle objects effectively hence are able to make use of tools for hunting and etcetera

Explanation:

what is the difference between the open-water zone and the deep water Zone ​

Answers

open water is seeable and deepwater is not

Two ramps of equal height are placed 1 m apart, and balls of equal mass are released from the top of each ramp. What happens to the motion of the balls when they meet in the middle?

The balls will move in a random direction.

The balls will stop.

The balls will continue moving forward.​

Answers

Answer:

The ball will stop

Explanation:

I don't know much about it.

Answer:

the balls will continue moving forward

How can scientific conclusions be reliable, but also able to be changed with the introduction of new evidence

Answers

Answer:

scientific conclusions are reliable as they are helpful for many things however it is true that after the evolution of new ideas the old theory have some changes or may change fully or may be proved wrong but yeah the old theories are still helpful for many reasons and things.

so I think scientific conclusions are reliable

Explain the role of aquaporins in the rapid movement of water through some cells

Answers

Answer:

In the early 1990s, aquaporins were discovered, and it was found that they can selectively control water movement into and out of cells. One of the critical functions of aquaporins is that while they allow the passage of water they prevent the passage of ions.

What struggles do aquatic organisms have that terrestrial ones do not?

If you are not going to actually answer the question don't even bother.

Answers

Answer:

Aquatic animals can be found in water habitats, which can be either fresh or marine. Terrestrial animals can be found exclusively in the land. Aquatic animals respire through gills or their skin. ... The main difference between aquatic and terrestrial animals is their habitat and modes of living

Explanation:

Answer:

being destroyed easily

Explanation:

aquatic organisms are faced with lots of challenges,,,eg.....oilspillage on water bodies,this prevents entry of oxgen into water hence suffocation leading to death,also growth of weeds such as water hyacinth which suck nutrientss and oxygen from water,,,also aquatic krganisms are hunted by lots of predators compared to that of terrestrial

Albino individuals lack all pigmentation so that their hair and skin are white. This pedigree shows that albinism -
Female
Male
1
Albino
Individuals
2
A is a sex-linked gene.
B is carried only by females in this family,

C requires both parents to be albinos.
D is a recessive genetic trait.

Answers

Answer:

I -Albino individuals

What are the characteristics of sodium?

Answers

Answer:

it is a soft metal

it react In a low melting point with a relative density

it is luster

it is of silver and white colour

it have ductility

Two dogs pull on a rope. One dog pulls with a force of 5 N to the left, and the other dog pulls with a force of 3 N to the right. What is the result?

A.The rope remains in place.

B.The rope moves to the left.

C.The rope moves to the right.

D.The rope has a balanced force applied to it.

Answers

Answer: It's B because there is more force pulling to the left.

Hope it helps. Brainliest?

Question 2 of 6 Which two pieces of data could indicate that a volcano is about to erupt? A. An increase in temperature near Earth's surface B. A change in the types of gas detected in the air OC. A drop in average air temperature in one region D. A decrease in the ocean level near a mountain range.
HELPP ME PLZZZZ​

Answers

The correct answer is A.

Answer:

A is the correct answer.

Why do the noble gases NOT form compounds readily?
Group of answer choices

They have an empty outer shell

They have a full valence shell

They have 7 valence electrons

They have no electrons

Answers

it's bc they have a full valence shell

Is the adaptation physical or behavioral. Humpback whales migrate north from Antarctica to breed in warmer water.

Answers

Answer:

okay so im going with a behavioural adaptation becasue if it was physical wouldnt that mean that they would change their appearance bc of there adaptation?

okie peace

Explanation:

Answer:

This adaptation is behavioral

Explanation:

What is the most likely reason the bones of the reptiles were found on more than one continent

Answers

Answer: Plate Tectonics

Explanation:

Meiosis occurs in male-female reproduction.
True or false?

Answers

Answer:true

Explanation:

Both males and females use meiosis to produce their gametes, although there are some key differences between the sexes at certain stages. In females, the process of meiosis is called oogenesis, since it produces oocytes and ultimately yields mature ova(eggs).

Why does the sun appear brighter than the other stars in the universe

Answers

Answer:

because its closer and bigger

Explanation:

its just closer and bigger than all of the other stars

The sun is many times larger than Earth but appears small because it is very far away. Even though the sun is very far from Earth, it is much closer than other stars. Because the sun is closer to Earth than any other star, it appears much larger and brighter than any other star in the sky.

Which of the following best describes a process by which metamorphic rock becomes igneous rock

A.weathering into sediments, then eroding
B.compacting under pressure and cementing
C.changing shape under heat and pressure
D.melting completely, then cooling

Answers

Answer: D. Melting completely, then cooling

Metamorphic rock melt, become magma (which is really just lava), and then comes to the Earth’s surface to eventually cool and become igneous rocks.

Which statement about how geologists study the ages of rock layers is true?
The law of superposition means that older rocks are on top.
Geologists can find the exact age of a rock by looking at its relative position.
The principle of original horizontality provides the basis for the law of superposition.
Relative age can be determined by using the concept of unconformity.

Answers

Answer: The principle of original horizontality provides the basis for the law of superposition.

Explanation:

The law of superposition in geology suggests that the rocks or sediments which are newly formed due to erosion and sedimentation of the original rocks lie above the old material. This law is supported by the principle of original horizontality according to which the newly formed sediments suspend horizontally in the layers of rocks and sediments under the effect of gravity. Thus an horizontal strata distinguishes the old and the new material.

Answer:

c

Explanation:

I took the quiz and got it right



If the individuals at Level IV - 1 and 2 had offspring, what do we know
could happen?

Answers

Answer:

all their kids might have the disease

Explanation:

if you do a Punnett square for the gene Xx X for female and X Y for male, then there is a 50 percent chance their kids would have the disease

Color blindness in humans is a sex linked trait. If the father has normal vision (XcY), and the mother is a carrier for the color blindness trait (Xc Xc), which percentage represents the chances of their sons being color blind?
A) 25%
B) 50%
C) 75%
D) 100%

Answers

A or B I think is the answer

what is the next step in the scientific method, following forming a hypothesis?
A. Analyzing the data
B. stating the question
C. conducting an experiment

Answers

Hi there!

The answer to this question, I believe, would be C, conducting an experiment. When you make your hypothesis, you have already stated your question, analyzed the data, and formed a logical assumption that you need to prove is true. Your hypothesis is your logical assumption; therefore, you ought to experiment and see if your assumption - your hypothesis - is correct.

Hope this helps! :)

Answer:

Conducting an experiment

Explanation:

What is the relationship between atmospheric pressure and the density of gas particles in an area of decreasing pressure? O As air pressure in an area decreases, the density of the gas particles in that area decreases. O As air pressure in an area decreases, the density of the gas particles in that area increases. O As air pressure in an area decreases, the density of the gas particles in that area remains constant. O As air pressure in an area decreases, the density of the gas particles in that area increases and decreases in an alternating pattern.​

Answers

Answer:

As air pressure decreases so does density of gas particles

Explanation:

Other Questions
Read the sentences.I want to be in London right now. I really want to see Big Ben and Buckingham Palace.Which sentence uses the subjunctive mood to express the ideas in the sentences?Going to London to see Big Ben and Buckingham Palace is a dream of mine.Going to London to see Big Ben and Buckingham Palace is a dream of mine. , ,I will go to London right now, and I will see Big Ben and Buckingham Palace.I will go to London right now, and I will see Big Ben and Buckingham Palace. , ,If I can get to London, I will see Big Ben and Buckingham Palace.If I can get to London, I will see Big Ben and Buckingham Palace. , ,If I were in London right now, I would go see Big Ben and Buckingham Palace.If I were in London right now, I would go see Big Ben and Buckingham Palace. , , Find the x and y intercept of this equation: -2x + 8y =4 write your solutions as a point in the form (x,y) How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . A human resources manager selected a random sample of 200 workers who donate to charity. The following table shows the distribution of the 200 workers. Count Type of worker Management Other white collar 96 50 S Blue collar 54 The manager conducts a goodness-of-fit test to determine whether the proportions of workers of these types are identical to the population proportions of workers donating to charity, which are 50 percent for management, 30 percent for other white-collar workers, and 20 percent for blue-collar workers. Which of the following statements must be true about the sample?A. The expected number of blue-collar workers donating to charity is less than 30. B. The expected number of management workers donating to charity is 100. C. The expected numbers of other white collar and blue-collar workers donating to charity are the same. D. The expected number of other white-collar workers donating to charity is 50 E. The combined expected numbers of other white collar and blue-collar workers donating to charity is greater than the expected number of management workers donating to charity. I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Find the sum or typeimpossible"Help Resources[1 -2 1] + [4 -5 -6]Skip[[?]Enter Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). The median for the 5 numbers 2647, 1956, 2250, 2141, and x is 2141. What is the largest possible value for the number x? HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :))) Mongar Corporation applies manufacturing overhead to products on the basis of standard machine-hours. Budgeted and actual overhead costs for the most recent month appear below: Original Budget Actual Costs Variable overhead costs: Supplies $7,980 $8,230 Indirect labor 29,820 29,610 Total variable manufacturing overhead cost $37,800 $37,840The original budget was based on 4,200 machine-hours. The company actually worked 4,350 machine-hours during the month and the standard hours allowed for the actual output were 4,190 machine-hours. What was the overall variable overhead efficiency variance for the month?a. $130 Unfavorableb. $950 Favorablec. $1,440 Unfavorabled. $1,310 Favorable The owner of Chips etc. produces two kinds of chips: lime (L) and vinegar (V). He has a limited amount of the three ingredients used to produce these chips available for his next production run: 4800 ounces of salt, 9600 ounces of flour, and 2000 ounces of herbs. A bag of lime chips requires 2 ounces of salt, 6 ounces of flour, and 1 ounce of herbs to produce; while a bag of vinegar chips requires 3 ounces of salt, 8 ounces of flour, and 2 ounces of herbs. Profits for a bag of lime chips are $0.40, and for a bag of vinegar chips $0.50. geometry ^please help me 8f5.Select the correct answer.es.How does the setting influence characterization in the text?esA.The setting causes the characters to use overly polite manners.B.The setting causes the characters to have difficulty riding the horses.C.The setting causes the characters to endure cold temperatures.OD.The setting causes the characters to have difficulty finding food.ResetNext