Answers
Related Questions
17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in
Answers
Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.
What is evaporation?As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.
It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.
Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.
Learn more about evaporation, here:
https://brainly.com/question/5019199
#SPJ5
How many chromosomes would you expect to be in the daughter cells of the mosquito after mitosis? When starting with 6
Answers
Answer:
i think it would be 12 since during mitosis it creates identical daughter cells which doubles up cells.
Explanation:
Answer:
12
Explanation:
HELP ASAP
Joe is experimenting to determine which liquid will cause bean plants to grow faster. He watered the plants with equal amounts of liquid and measured their height every other day. The plants are in the same pots with different soils and placed in the same location. Will Joe be able to obtain reliable data to write a supported conclusion?
Yes, because he is only observing the height of the plant.
Yes, because he is consistent with watering the plants.
No, because he used different soils.
No, because he uses only one type of plant.
Answers
Answer:
No, because he used different soils.
Explanation:
which liquid will cause bean plants to grow faster.
He watered the plants with equal amounts of liquid and measured their height every other day.
The plants are in the same pots with different soils and placed in the same location.
Ok so last statement made the experiment wrong.
As a constant variable the soil should be the same for all plants only the liquid should change
PLEASE HELPPPPPPP
(Monstro the Goldfish & Epigenetics)
Answers
Answer:
mmmmmmmmmmmmdddddd
Explanation:
ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
What kind of inheritance is horse color an example of?
A. Complete dominance
B. Incomplete dominance
C. Co-dominance
Answers
Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?
A)Enzymes do not affect the energy of a reaction.
B)Enzymes slow down reactions so products can form.
C)Enzymes can be reused because they do not permanently bond with substrate.
D)Enzymes can only bind to other enzymes so the same product is formed each time.
Answers
Answer: C
Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.
Enzymes can be reused because they do not permanently bond with substrate.
What are Enzymes?
A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.
Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.
Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.
Therefore, Enzymes can be reused because they do not permanently bond with substrate.
To learn more about Enzyme, refer to the link:
https://brainly.com/question/14953274
#SPJ6
How does evolution result in reproductive success?
Answers
Answer:
Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.
Helpppppppppppppppppppppppppppppppppp
Answers
Answer:
umm i dont understand your question
Explanation:
Once assembled, what is the key to a protein's unique function?
Answers
Answer:
Once assembled, what is the key to a protein's unique function? The manner in which proteins fold is the key to their function
The endoplasmic reticulum is an important region where protein folding occur. Because proteins need to be appropriately folded into distinct structures, this is an essential biological function.
What is importance of protein folding?Proteins that are misfolded or are unfolded improperly impart to the pathophysiology of many illnesses.
Protein folding is a highly delicate process that is regulated by a variety of external stimuli, such as temperature, pH, chemicals, molecule crowding, electric and magnetic fields, and temperature.
These elements affect a protein's capacity to fold into the appropriate functional forms.
Therefore, Protein folding give unique properties to protein functions.
Learn more about protein folding here:
https://brainly.com/question/28421475
#SPJ2
Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP
A. Transport from complex I produces more ATP.
B. Transport from complex II produces more ATP.
C. Both produce the same amount of ATP.
Answers
Answer:
A
Explanation:
ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.
Electron transport from complex I produces more ATP.
ELECTRON TRANSPORT CHAIN:
The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration. The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis. The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers. Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space. Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.Learn more: https://brainly.com/question/442662?referrer=searchResults
HURRY. Why is transcription said to be unidirectional?
Answers
Answer:
Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.
Explanation:
Why do the cells used for reproduction only have half (½) of the DNA that other cells have?
Answers
Answer:
Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.
Explanation:
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answers
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
6B(SCIENCE) (6BB OOB)
4
What is the difference between evaporation and boiling? *
(1 Point)
A) There is no difference - they are exactly the same.
B) Evaporation, unlike boiling, occurs at all temperatures.
C) In evaporation, unlike in boiling, there is no state change.
D) In boiling, unlike in evaporation, the liquid volume reduces.
This question is required.
Answers
PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.
Answers
Answer:
No, not according to any sciences (unless you mean aliens as in immigrants)
Explanation:
There is no way that we are the only living thing in the entire world. There has to be another species out there. They might be wondering if there is another living thing out in space too.
What is the atomic mass of Sulfur that has 18 neutrons?
Answers
Answer: 32.066 atomic mass units
B is the correct option.
Molecules of DNA are composed of long chains of?
Answers
two long polynucleotide chains
A DNA molecule consists of two long polynucleotide chains composed of four types of nucleotide subunits. Each of these chains is known as a DNA chain, or a DNA strand. Hydrogen bonds between the base portions of the nucleotides hold the two chains together
Molecules of DNA are composed of long chains of nucleotides.
What are nucleotides?Nucleotides are the building blocks of DNA and RNA adenine (A), thymine (T), guanosine (G), and Cytosine (C. In RNA, uracil (U) is present instead of thymine.
The pentose sugar is the ribose sugar in RNA and deoxyribose sugar in DNA. In deoxyribose sugar, oxygen is absent from the 3' carbon.
Phosphate groups are attached through the 5-C of pentose sugar by an ester bond. One polynucleotide chain is formed when the phosphate of one nucleotide forms a phosphodiester bond with the sugar of another nucleotide.
A double-stranded structure is formed by base pairing between nucleotides. The adenine binds to thymine by two hydrogen bonds and guanine binds to cytosine by three hydrogen bonds.
Therefore the molecules of DNA are composed of long chains of nucleotides.
Read more about nucleotides, here
https://brainly.com/question/13185536
#SPJ6
the biotic factors of each land biome are determined by its ___
climate
organisms
location
size
Answers
Answer:
climate
Explanation:
Which of the following are sources of extra nutrients that can cause algae to overgrow in water due to HUMAN activity? CAREFULLY select all options that apply. List the answers.
dissolved oxygen in water
treated waste water
viruses
combined sewage overflow (CSO)
fertilizers
cleaning products
dog poop on the streets of NYC
water running over rocks
(This is 7th grade science)
Answers
Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.
Answers
Answer:
The answer is B
B. They are both made of subatomic particles.
20 points and will mark brainliest! Please explain how you got it though
Answers
Answer:
crossing over during meiosis
Explanation:
i just had biology last semester hope this helps
Most stars seem to move across the night sky because
a. the universe is expanding
b.the universe is getting smaller
c. Earth is orbiting the Sun
d. Earth is spinning on its axis
Answers
I think it is C but uh if its not D Hope this helps-
Explanation: because
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
Answers
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
write a short paragraph on hydra
Answers
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
identify and explain three environmental impacts of current agricultural methods
Answers
Explanation:
It is profit making practice but it causes increased level of pathogens.
It has increased the level of chemicals in our land and water.
It has increased levels of greenhouse gases in air.
What parts of the body make up the central nervous system
Answers
Answer:
brain and spinal cord
Explanation:
that's it
If the process of meiosis shown to the right proceeds
normally, how many
chromosomes will cells A, B, C, and D have?
B
Answers
Answer:
If I’m correct it’s 15
Explanation:
which layer of the earth is made out of melted metal?
Answers
The outer core. A molten nickle- iron alloy.
How can agriculture cause soil pollution?
Answers
Agriculture pollution
Explanation:
Agriculture is a main source of pollution in lake water. chemical and fertilzer
Answer:
Pesticides and fertilizers used on crops fed to animals are a major contributor to land pollution
Explanation:
hope this helps :)
Which statement best explains the myth about how Romulus and Remus founded Rome?
Answers
Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.
Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer
