Which histogram represents a set of data that is left-skewed? A graph shows the horizontal axis numbered 56 to 126. The vertical axis is numbered 1 to 5. The graph shows an upward trend from 56 to 77 then a downward trend from 77 to 119. A graph shows the horizontal axis numbered 60 to 114. The vertical axis is numbered 1 to 4. The graph shows a downward trend from 60 to 72, an upward trend from 72 to 84, then a downward trend from 84 to 108. A graph shows the horizontal axis numbered 351 to 1,287. The vertical axis is numbered 2 to 6. The graph shows an upward trend from 1 to 1,053 then a downward trend from 1,053 to 1,701. A graph shows the horizontal axis numbered 252 to 1,260. The vertical axis is numbered 1 to 5. The graph shows an upward trend from 1 to 630, a downward trend from 630 to 756, an upward trend from 756 to 882, then a downward trend from 882 to 1,341.

Answers

Answer 1

Left skewed histograms are shown by the left tail , smaller values, being longer then the right tail, larger values.

The answer is: A graph shows the horizontal axis numbered 351 to 1,287. The vertical axis is numbered 2 to 6. The graph shows an upward trend from 1 to 1,053 then a downward trend from 1,053 to 1,701

Answer 2

Answer:

A

Step-by-step explanation:

EDGE 2021


Related Questions

Determine the slope and y-intercept. 4x + y = -10

Answers

Answer:

slope = -4

y-intercept = -10

Step-by-step explanation:

First, isolate the y. Note the equal sign, what you do to one side, you do to the other. Subtract 4x from both sides:

4x + y = -10

4x (-4x) + y = -10 (-4x)

y = -4x - 10

Note the slope intercept form: y = mx + b

y = y

m = slope = -4

x = x

b = y-intercept = -10

Answer:

slope m=-4

y intercepts (0,-10)

Step-by-step explanation:

Which statements are true about surface area and volume? Check all that apply. Volume is labeled with cubic units. Surface area is labeled with cubic units. Volume of a prism is the product of the area of the base and height. Surface area is the sum of the areas of each side. The volume of a prism is One-third the volume of a pyramid.

Answers

We will review each option and see that it corresponds:

-Volume is labeled with cubic units.

True, the units of volume are cubic, since it is distance to the cube.

-Surface area is labeled with cubic units.

False, the units of the area are square, since it is distance squared

-Volume of a prism is the product of the area of the base and height.

True, depending on the base, the volume of the prism is determined, therefore it would be the area of the base by the height.

-Surface area is the sum of the areas of each side.

True, the surface area corresponds to the sum of the lateral areas and the area of the base, that is, the area of each side.

-The volume of a prism is One-third the volume of a pyramid.

False, on the contrary, the volume of a pyramid is one third of the volume of a prism

Answer:

A

C

D

Step-by-step explanation:

Hope you guys have a good day!

One of these pics are proof and the other is to just make you smile :)

Stephanie has 4,500 in her savings account. If it earns 6% interest every month how much money does Stephanie have her bank account after 3 months?

Answers

Answer:

5,310

Step-by-step explanation:

6% of 4,500 is 270

270×3 is 810

810+4,500=5,310

Today, everything at a store is on sale. The store offers a 20% discount.If the regular price of an item is x dollars, what is the discount price in dollars? Type the correct expression in the box below.

Answers

Answer:

0.80x dolllars

Step-by-step explanation:

20% discount of the total amount is

0.20 * x dolllars

So if you start with x dollars you need to subtract the discount to get the new (lower ) price.

x - (0.20 * x) dolllars

1* x - 0.20 * x

x * 1 - 0.20 * x

x * ( 1 - 0.20 )

x * ( 0.80 )

0.80x dolllars

* Approximate the value of V5 to the nearest hundredth.

Answers

Answer:

2.24

Step-by-step explanation:

If you mean sqrt(5), then the answer is 2.236, which rounds to 2.24

I'm going to assume you mean √5.

√5 is not a perfect square but it can evaluated into a non-terminating decimal.

√5 = 2.23606797...

Round to the nearest hundredth.

2.23606797... → 2.24

Therefore, the answer is 2.24

Best of Luck!

Frankie was practicing for a 5 kilometer race his normal time is 31 minutes and 24 seconds but yesterday he took 29 minutes and 50 seconds how much time came of his normal time

Answers

Answer: 1 minute 34 seconds

Step-by-step explanation:

From the question, Frankie was practicing for a 5 kilometer race and his normal time is 31 minutes and 24 seconds but yesterday he used 29 minutes and 50 seconds. To calculate how much time came of his normal time, we are going to find the difference between the yesterday's time and normal time. This will be:

31 minutes 24 seconds - 29 minutes 50 seconds = 1 minute 34 seconds

Chloe purchased 4 apps online. She paid 6% in sales tax. Her total cost was $4.24. What was the price of each app, not including the sales tax?

Answers

The total price before tax is 4.24/1.06=$4

The price of each app was $1.

Find mZA.
Note that mZA is acute. Round to the nearest degree.
5
10
B
28°​

Answers

My answer is 17.54 degrees

Alex surveyed his classmates to determine who has been surfing and who has been snowboarding. Let A be the event that a classmate HAS snowboarded and let B be the event that a classmate HAS surfed.
If Alex picked a classmate at random, what is P(B/A) ?

A. 4/21
B. 3/4
C. 4/25
D. 25/28

Answers

Answer:

surburu

Step-by-step explanation:

Answer:

B. [tex]\frac{3}{4}[/tex]

Step-by-step explanation:

I got this question correct. :)

A: SnowboardedB: SurfedP(B|A) = P(A and B) / P(A)

P(Surfed|Snowboarded) = P(Surfed and Snowboarded) / P(Snowboarded)

Amount surfed and snowboarded: 36Total amount snowboarded: 48

P(B|A) = [tex]\frac{36}{48}[/tex] = [tex]\frac{3}{4}[/tex]

Apologies for lack of explanation, but I think this will do it.

Can someone please help me? I keep losing points...

CORRECT ANSWERS ONLY PLEASE!!!!

Use the formula i = prt, where i is the interest earned, p is the principal (starting amount), r is the interest rate expressed as a decimal, and t is the time in years.

Answers

Answer:

$93,996

Step-by-step explanation:

i = prt

i = ($53,712)(.15)(5)

i = $40, 284

$40, 284 + $53,712

$93,996

Answer:

$92996

Step-by-step explanation:

Using the given formula :

I = P × R × T

I = 53712 × 15/100 × 5

I = $40284

He has = 40284 + 53712 = $93996

A basketball has a circumference of 31.4 inches. Using 3.14 as an approximation for pie, what is the basketball's volume to the nearest cubic inch?

Answers

Answer:

0.52 cubic inches

Step-by-step explanation:

Given: circumference of a basketball is 31.4 inches.

[tex]\pi =3.14[/tex]

To find: basketball's volume to the nearest cubic inches

Solution:

circumference of a basketball (sphere) = 6.28(radius)

Also, circumference of a basketball = 31.4 inches.

So, 6.28(radius) = 3.14

radius = [tex]\frac{3.14}{6.28}=\frac{1}{2}[/tex] inch

Volume of the basketball (sphere) = [tex]\frac{4}{3}(\pi )(radius)^3=\frac{4}{3}(3.14)(\frac{1}{2})^3=0.52\,\,cubic\,\,inches[/tex]

Consider this right triangle with the given measures.

A triangle has side lengths 5 inches and 12 inches. The hypotenuse is unknown.

What is the length of the hypotenuse?

1.  52 + 122 =c2

2.  25 + 144 =c2

3.  169=c2


c=

Answers

Answer:

c=13

Step-by-step explanation:

You then square root both sides of the equation and the square root of 169 is 13.

Hope this helps! :)

Answer:

c is 13

Step-by-step explanation:

trust me bro

You're playing a game where you defend your village from an orc invasion. There are 3 characters (elf, hobbit, or human) and 555 defense tools (magic, sword, shield, slingshot, or umbrella) to pick from.
If you randomly choose your character and tool, what is the probability that you won't be a hobbit or use an umbrella?

Answers

Answer:

There is a 1/3 chance of getting a hobbit, and a 0.1/11 chance of getting an umbrella.

Explain which is the better value for money
a) 250g of spread at $1.85, or
B) 500g of spread at $3.10, or
C) 1 kg of spread at $5.90,

Answers

Answer:

The answer is C.

Step-by-step explanation:

To start off 250g is $1.85 and we want to get to 500g so if we add $1.85 with $1.85 we will get $3.70.  This amount is more than the number if we bought just 500g once than if we bought 250g twice, because if we did, we would be paying more.  But that's not all, if we add 500g with 500g we will get $6.20.  That's more than the original price for 1 kg and if we multiply 250g 4 times than we get 7.4.  So in all we would buy 1 kg.

What is the value of z?
A.95
B.126
C.77
D.154

Answers

Answer:

B. 126

Step-by-step explanation:

85*2=170

170+64+x=360

234+x=360

x=126

A spinner has 5 equal sections labeled 1 through 5. The bar graph shows the results of spinning the spinner 100 times. Which statement is true about not spinning a 1?

Answers

Answer:

The experimental probability is less than the theoretical probability.

Step-by-step explanation:

The probability of not spinning a 1 is the complement is 0.8.

What is probability?

It is the chance of an event to occur from a total number of outcomes.

The formula for probability is given as:

Probability = Number of required events / Total number of outcomes.

Example:

The probability of getting a head in tossing a coin.

P(H) = 1/2

We have,

The theoretical probability of not spinning a 1 is 4/5 or 0.8.

This is because there are 4 sections labeled 2 through 5 that are not labeled 1, out of a total of 5 sections.

The probability of spinning a 1 is 1/5 or 0.2.

So the probability of not spinning a 1 is the complement of that, which is 4/5 or 0.8.

or

= 1 - 1/5

= 4/5

= 0.8

Thus,

The probability of not spinning a 1 is the complement is 0.8.

Learn more about probability here:

https://brainly.com/question/14099682

#SPJ3

one person has corona virus then ten more people catch it how many people have corona virus

Answers

Answer:

11

Step-by-step explanation:

Answer:

11

Step-by-step explanation:

1 - Person already infected

10 - People who got the virus

1 + 10 = 11

Which set of three angles could represent the interior angles of a triangle?
A:199, 709, 910
B:470, 120, 310
C:50°, 20° 20°
D:250, 250, 100%

Answers

C would be the correct answer

Answer: B

Step-by-step explanation:

Cake is shared among Mary, Ann and Susan in the ratio 2 : 5 : 7. If Susan's share is 6 pieces more than twice the share of Mary, find the number of pieces of cake Ann gets.

Answers

Answer:

the answer is 6

Step-by-step explanation:

what is the median of the following number: 40, 49, 62, 56, 68, 39, 50, 61, 54, 44

Answers

Answer:

52

Step-by-step explanation:

39, 40, 44, 49, 50, 54, 56, 61, 62, 68

39, 40, 44, 49, 50, 54, 56, 61, 62, 68

[tex]\frac{50 + 54}{2}[/tex] = [tex]\frac{104}{2}[/tex] = 52

Answer:

52

Step-by-step explanation:

A cylinder and it’s dimensions are diameter 8.4cm and height 10.9cm. Which measurement is closest to the lateral surface area of the cylinder in square centimeters

Answers

Answer:

287.64

Step-by-step explanation:

2πrh is the formula you use for the lateral surface area.

to get radius, we know its half of the diameter so 4.2.

plug them in and you get your answer :)

A commercial airplane travels 5,000 feet east and then ascends 3,000 feet from its starting point in the sky. Upon noticing a severe storm system on the horizon, the pilot decides to return to the starting point. A) how much distance does the plane have to travel to turn back? B) at what angle would the plane need to travel to return to its starting point. (1,000 feet = 1 unit)

Answers

Answer:

A) 5830.95 B)59.04

Step-by-step explanation:

Solve for the hypotenuse of 5,000 and 3,000

Use tangent to find the angle

tanx = 5,000/3,000

x=59.04

The distance the plane has to travel to turn back is 5830.95 km.

The angle would the plane need to travel to return to its starting point is 59.04°

How to find the distance?

Solve for the hypotenuse of 5,000 and 3,000

Use tangent to find the angle

tanx = 5,000/3,000

x = 59.04

Height is the size of an object in the vertical course and distance is the measurement of an object from a specific factor in the horizontal route.

Learn more about Height and distance here: https://brainly.com/question/25638875

#SPJ2

simple math

Sam is in charge of setting up rooms for parties at a hotel. On Saturday, there are two parties, one with 496 people and one with 784 people. Each table seats 8 people. How many total tables does he need for the two parties?

Answers

Answer:

160

Step-by-step explanation:

add the numbers together then divide by 8

A small bag of pretzels costs $0.99 and contains 4 ounces. A large bag of pretzels costs $2.99 and contains 15 ounces. Which is the better buy?

Answers

Answer:

$2.99 is the better buy

Step-by-step explanation:

First, find the unit price for each bag of pretzels. This can be found by the formula: (cost/amount). in this case it is (cost/ ounce)

This means:

0.99 bag for 4 ounces means about 25 cents per oz

2.99 bag for 15 oz means about 20 cents per oz

The lower the unit price, the better the buy.

Each ounce is cheaper with the 2.99 bag, therefore it is the better choice.

Which of the following is the graph of y = sin(0.5x)?
On a coordinate plane, a curve crosses the y-axis at (0, 0). It has a maximum of 1 and a minimum of negative 1. it goes through 2 cycles at 24 pi.
On a coordinate plane, a curve crosses the y-axis at (0, 0). It has a maximum of 1 and a minimum of negative 1. it goes through 2 cycles at 2 pi.
On a coordinate plane, a curve crosses the y-axis at (0, 0). It has a maximum of 1 and a minimum of negative 1. it goes through 1 cycle at 8 pi.
On a coordinate plane, a curve crosses the y-axis at (0, 0). It has a maximum of 1 and a minimum of negative 1. it goes through 2 cycles at 8 pi.

Answers

Answer: On a coordinate plane, a curve crosses the y-axis at (0, 0). It has a maximum of 1 and a minimum of negative 1. it goes through 2 cycles at 8 pi.

Step-by-step explanation:

The function is y = sin(0.5*x)

We know that sin(0) = 0, so this graph must pass trough the point (0,0)

We know that the maximum of the sin(x) is 1, when x = pi/2. and the minimum is -1 when x = (3/2)*pi

but in our case the function is valuated in 0.5*x

then the maximum is when:

0.5*x = pi/2

x = pi/(2*0.5) = pi

and the minimum is when

0.5*x = (3/2)*pi

x = 3*pi

Now, knowing that sin(2*pi) = 0

The other 0 of the sin is when we have 0.5*x = 2*pi

x = 2*pi/0.5 = 4*pi

this means that in 4*pi we have one cycle, then in 8*pi we have tow cycles.

Then the correct option is:

"On a coordinate plane, a curve crosses the y-axis at (0, 0). It has a maximum of 1 and a minimum of negative 1. it goes through 2 cycles at 8 pi."

Answer:

d

Step-by-step explanation:

Grant is replacing his aquarium. His old aquarium was in the shape of rectangular prism with a volume of 5,184 cubic inches.

The new aquarium is also a rectangular prism with a length, width, and height that are each 5/8 times as long as the corresponding dimension of his old aquarium. Grant concludes the two aquariums are geometrically similar figures. Which statement is true?

A. The two aquariums are similar, and the volume of the new aquarium is 3,000 cubic inches.
B. The two aquariums are similar, and the volume of the new aquarium is 4,320 cubic inches.
C. The two aquariums are not similar, and the volume of the new aquarium is 3,000 cubic inches.
D. The two aquariums are not similar, and the volume of the new aquarium is 4,320 cubic inches.

Answers

Answer:

The answer is B

Step-by-step explanation:

hi I need some help...
-6y + 17 = 3y -10

Answers

Answer:

y=3

Step-by-step explanation:

Solve by subtracting

[tex]-6y + 17 = 3y -10\\-6y=3y-27\\-9y=-27\\[/tex]

Divide.

[tex]-9y=-27\\y=-27/-9\\y=3[/tex]

Answer:

3

Step-by-step explanation:

During December,an electronics store saw a 27% increase in video game sales.If the store sold an average of $47,300 in video games during each other month,how much more money did it earn in December for video game sales?

Answers

Answer:

It earned $12,771 more in December.

Step-by-step explanation:

This question can be solved using a rule of three.

During an average month, we have that 100% = 1 is $47,300.

During December, the amount is $x, and it is 100% + 27% = 127% = 1.27. So

1 - $47,300

1.27 - $x

x = 1.27*47,300

x = 60,071

It earned $60,071 in December.

Compared to other months, it earned $60,071 - $47,300 = $12,771 more in December.

Please help! Very confused

Answers

Answer:

a

Step-by-step explanation:

What is the value of r in the equation?

Negative 1.5 (4 minus r) = negative 12
–6
–4
4
6

Answers

Answer:

The answer is -4

Step-by-step explanation:

that would be because that is the answer

the correct answer is B.)  -4      

Other Questions
Everlys school is located at the midpoint between her house and the library. Find the location of her school if her house is located at (8, 1) and the library is at (-2, -5).Group of answer choices(3, -2)(5, 3)(10, 6)(6, -4) Evaluate 9 b 9b9, minus, b when b = 8b=8b, equals, 8. what is the degree of x^4-3x+22 How does the American work week compare to the rest of the world? Is this better for US or them? Defend your answer with facts. EquationsWhat is the solution of the system of linear equations?-3x + 4y = -182x - y = 7(-2,-3)(-2,3)(2, -3)(2, 3) How does the narrator repeating My favorite at the beginning of every paragraph contribute to the story? (My favorite things by joy cowley) If 14 moles of Oxygen burn how many moles of water are created? *2C2H6+7024CO2 + 6 H2OA) 12 mol H20B) 3.5 mol H20C) 3 mol H20D) 42 mol H20 2x +6 = 8xwhat are the values of x here? can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Please help ASAP will mark brainliest Dextra Computing sells merchandise for $15,000 cash on September 30 (cost of merchandise is $12,000). The sales tax law requires Dextra to collect 5% sales tax on every dollar of merchandise sold. Record the entry for the $15,000 sale and its applicable sales tax. Also record the entry that shows the payment of the 5% tax on this sale to the state government on October 15. View transaction list Journal entry worksheet Record the cost of September 30th sales. Note: Enter debits before credits Date General Journal Debit Credit Sep 30 Record entry Clear entry View general journal Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG John and Ellen bought a big pizza. Ellen ate 2/4 of the pizza and John ate 1/3 of the pizza. How much did they eat all together? How much was left over? (Hint: 12 is the Lowest Common Denominator).(1/4 was wrong plss helppp) brainliest & points!i need help with math asap, show work too if possible :) Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) Poems are often ambiguous because _____. Which statement best describes the impact of the dust bowl?A. consumers brought more Texas crops when Kansas crops were destroyed B. Farmers on the Great Plains could not grow crops and many left for California C. Farmers increased their use of groundwater to irrigate their crops D. Workers migrated from the cities to the countryside to help grow food