Which is a feature of a tonic receptor? Select one: a. The action potential occurs when there is a change in response to a change in condition. b. For this receptor, the stimulus begins with a burst of action potentials. c. They are normally inactive. d. When the stimulus changes the action potential generation changes. e. Provides information about the rate and change of the stimulus. f. The action potential is generated for a short time period.

Answers

Answer 1

Answer:

For this receptor, the stimulus begins with an explosion of action potentials.

that would be the correct option.

Explanation:

A tonic receptor is one that is activated when the action potentials were maintained over time and during the signaling of the receptor.

Tone receptors require continuous stimulation over a period of time to trigger a response and deliver it to the central nervous system.

It keeps the nervous system constantly active in the environment that surrounds it.

They are slowly adaptable, an example of these receptors are the merkel and ruffini receptors.


Related Questions

If tall is dominant over short, and yellow seed is dominant over green, how would you write the genotype of a pea plant that is heterozygous for tall, and that produces yellow seeds

Answers

Answer:

The answer has been written in paper and the image of the paper has been attached. Feel free to raise any doubt.

As a substance is eaten, trace its path through the digestive system. Include one of the basic processes each step of the way: digestion, absorption, motility, secretion, and excretion.

Answers

Answer:

....... motility

Explanation:

Biochemical and genetic experiments have demonstrated that the _________ of tRNA are important for recognition by its cognate aminotransferase-tRNA synthetase.

Answers

Answer:  Acceptor stem and anticodon loop.

Explanation:

Transfer RNA (tRNA) is a small RNA nucleic acid involved in protein synthesis (translation). Each tRNA molecule has two important areas:

A region of trinucleotides, called the anticodon A region where a specific amino acid binds.

During translation, the ribosome reads the sequence of the mRNA in groups of three bases to assemble the protein. So, in the mRNA chain there are codons, set of three bases, which determine the amino acid to be added to the peptide chain. The tRNA transfers the amino acid to the ribosomes, and then arranges them along the messenger RNA (mRNA) molecule. Then, the tRNA must have an anticodon that is complementary to the codon. Each type of tRNA is specifically combined with 1 of the 20 amino acids to be incorporated into proteins.

This means, during translation, each time an amino acid is added to the growing chain, a tRNA molecule is formed whose base pairs have a complementary sequence with mRNA molecule, ensuring that the appropriate amino acid is inserted into the protein. So, tRNA is a key link between RNA transcription and the translation of that RNA into protein. On the other hand, aminotransferases are enzymes responsible for attaching amino acids to the 3ʹ‐end of cognate tRNAs.

The acceptor stem is the site of attachment of amino acids to tRNA, and anticodon loop is the site of tRNA that is complementary to the codons found in mRNA (that determine the amino acid that will be added) This means, both parts are important for recognition, because the acceptor stem is where the amino acid is, and the anticodon loop ensures that the appropriate amino acid is inserted into the protein.

The medical term ____________________ describes a pus-filled lesion on the eyelid resulting from an infection in a sebaceous gland.​

Answers

Answer:

the medical term is hordeolum

which type of soil is likely to be found in horizon E

Answers

Answer:

A layer of pale,Sandy soil lacking clay and iron is likely to be found in horizon E

Answer:

bedrock

Explanation: A layer or bedrock is the type of soil is likely to be found in horizon E. Hence the correct answer is option A among the options. The bed rocks can be regarded very hard and it cannot be breakable.

Which of the following is NOT a factor of sustainability?
Group of answer choices

economics

ethics

biodiversity

natural capital

solar energy

Answers

Answer:

natural capital

HOPE IT HELPS!

PLS MARK AS BRAINLIEST!!!

A purebred tall pea plant is cross-pollinated with a tall, heterozygous pea plant. Use a Punnett square to determine the probability the offspring inherita
recessive short allele. (I point)
75%
25%
0%
50%

Answers

Answer:

0%

Explanation:

This question involves a gene coding for height in pea plants. The allele for tallness (T) is dominant over the allele for shortness (t). This means that allele T will be expressed over allele t in an heterozygous state.

A purebred tall plant will possess genotype: TT while a heterozygous tall plant will possess genotype: Tt. The two parents will produce the following gametes:

TT- T and T

Tt- T and t

Using these gametes in a punnet square (see attached image), the following offsprings with genotypes: TT and Tt in a ratio 1:1 will be produced.

TT offsprings are purebreed tall while Tt offsprings are heterozygous tall. Hence, based on the question, no offsprings of this cross will possess the recessive genotype (tt). This means that 0% of the offsprings of this cross will be short.


Which of the following groups gets energy directly from the grass it eats?

Answers

Answer:

herbivores

Explanation:

i think it's herbivores because "herb"ivores get energy when eating grass or any other herb.

Which of the following properties is the temperature at which a liquid turns to gas? (3 points)
оа
Magnetism
Ob
Thermal conductivity
ос
Melting point
Boiling point
Od

Answers

thermal conductivity

Answer:

Boiling point

Explanation:

I did the test

A red flower producing snapdragon plant is crossed with a white flower producing snapgragon plant. Resulting F1 generation is crossed with one another to produce F2 generation.

This is incomplete dominance of genes.

Q1 What type of a breeding is this? (monohybrid, dihybrid or interspecific)

Q2 Draw a genetic chart to show P, F1 and F2 generations clearly indicating genotypes, phenotypes and generations.



Answers

Answer:

See the answer below

Explanation:

1. This is an example of monohybrid breeding. A monohybrid breeding is the type of breeding that involves parents with a pair of contrasting characters. On the other hand, a type of breeding involving a single gene is what is known as monohybrid breeding.

2. When a red flower snapdragon is crossed with a white flower snapdragon, the resulting offspring are usually pink - an indication of incomplete dominance of the gene responsible for flower color. Assuming the red flower's genotype is AA and that of the white flower is aa:

                       AA      x      aa

                 Aa      Aa      Aa      Aa

F1 genotype = all Aa

F1 phenotype = pink flower

At F2:

                          Aa      x      Aa

                 AA         2Aa           aa

F2 Genotype/phenotype:

       1AA - red color

       2Aa - pink flower color

        1 aa - white flower color.

Why do you think premenopausal women need more iron than
men of the same age?

Answers

Answer:

Women need more iron than men to make up for the amount of iron they lose in their menstrual period.

Explanation:

Answer:

Premenopausal women shed blood as part of menstruation every month, which lowers the level of iron in the body. So, they need more iron than men and are also at a greater risk for this nutritional deficiency.

PLATO

Explanation:

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG

Answers

Answer:

a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA

Explanation:

The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20  nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:

Schematically:

The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:

5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'

The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:

3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'

Cloning to produce embryonic stem cells is called A) regenerative cloning. B) transplantational cloning. C) reproductive cloning. D) therapeutic cloning. E) dedifferentiation.

Answers

Answer:

D

Explanation:

The correct option would be therapeutic cloning.

First and foremost, cloning refers to the process of producing genetically and phenotypically similar organisms or cells from a single organism/cell, be it naturally or artificially. The genotypically and phenotypically similar copies of the original organism are called clones.

Artificial clonings are of different types, namely:

Reproductive cloningGene cloningTherapeutic cloning

Reproductive cloning has to do with producing genetically identical organisms from a particular organism while gene cloning involves producing exact copies of a gene or segments of DNA. Therapeutic cloning, however, involves the production of embryonic stem cells in order to create tissues that would replace similar but damaged or worn-out tissues in living organisms.

Correct option: D

which particles is the fundamental unit of all matter in both living and nonliving

Answers

Answer:

atoms

Explanation:

all things in the universe are made of atoms and they are considered the fundamental unit of matter.

non-living things are composed of different compounds and molecules.

living things are made of cells, and cells themselves are made of different molecules. So living things are also made of atoms.

I need help FAST!! U have too match the letters with the #.!

Answers

8 B

9 B

10 D

11 C

12 C

13 B

14 A

15 A

16 C

17 A

18 A

19 D

20 A

21 D

22 D

Put the vocabulary words in order from largest level of organization to smallest. Reorder answers 1. Population Reorder answers 2. Organism Reorder answers 3. Organ Reorder answers 4. Atom Reorder answers 5. Biosphere Reorder answers 6. Species Reorder answers 7. Organ system Reorder answers 8. Community Reorder answers 9. Cell Reorder answers 10. Ecosystem Reorder answers 11. Organelle Reorder answers 12. Tissue Reorder answers 13. Molecule

Answers

Answer:

The level of organization in order from largest to smallest is;

1. Biosphere

2. Ecosystem

3. Community

4. Population

5. Species

6. Organism

7. Organ system

8. Organ

9. Tissue

10. Cell

11. Organelle

12. Molecule

13. Atom

Explanation:

All living things on Earth are arranged in an hierarchical level of organization. The order in descending way is as follows:

1. Biosphere- Biosphere refers to the part of the Earth that constitutes all living organisms in interaction with their environment. It is the total of all ecosystems on Earth.

2. Ecosystem: Ecosystem refers to a group of living organisms i.e plant, animal and microbes interacting with each other and their abiotic environment e.g water, air etc. An ecosystem comprises of several communities.

3. Community- Community refers to a group of organisms interacting with each other at a particular time and habitat. A community is made up of two or more populations.

4. Population- Population refers to a group of organisms of the same species living together in the same habitat and capable of interbreeding.

5. Species- A species is a group of organisms usually with the same appearance and capable of producing fertile offsprings by interbreeding.

6. Organism- An organism is an individual living thing i.e. plant, animal, microbe. An organism is made up of several organ systems that work together to make it whole.

7. Organ system- Organ system refers to a group of organs working in an interconnected manner to perform certain functions in an organism.

8. Organ- An organ is a structure in an organism that performs a specific function.

9. Tissue- A tissue is a group of cells working together for the same purpose.

10. Cell- A cell is the basic and fundamental unit of life, which is the building block of all living organisms.

11. Organelles- An organelle is a specialized structure in a cell that performs specific functions. e.g. nucleus, mitochondria etc.

12. Molecule- A molecule is the smallest unit of a chemical compound responsible for the chemical identity of that compound. A molecule is made up of two or more atoms chemically bonded together.

13. Atom- An atom is smallest indivisible unit of mattter that partakes in chemical reactions. Atom is considered the smallest unit of matter.

Answer:

:)

Explanation:

Reaching for your coffee cup is accomplished by the _____ subdivision of the peripheral nervous system.

Answers

Answer:

somatic subdivision

Explanation:

The peripheral nervous system is divided into somatic and autonomic systems. The somatic system is required to transport sensory and motor information to the central nervous system. The somatic system is composed of nerves that connect different parts of the body including sensory fibers, skin, and skeletal muscles. On the other hand, the autonomic system can be subsequently classified into sympathetic and parasympathetic systems, which are required in fight (potentially dangerous) and calm-associated responses, respectively.

what are 3 major functions of the femur?

Answers

Answer:

The femur is the longest bone in the human skeleton. It functions in supporting the weight of the body and allowing motion of the leg. The femur articulates proximally with the acetabulum of the pelvis forming the hip joint, and distally with the tibia and patella to form the knee joint.

Explanation:

Holding the body weight once standing and moving. People are being stabilized as they move. Connecting the hips and knees' muscles, tendons, and ligaments to the rest of your body. These are three functions of femur.

What is femur?

The femur is the bone in the thigh. It is person's body's longest and strongest bone. It is an essential component of the ability to stand and move.

There can be many functions of this bone, some are listed below:

Hold the body weight.Stabilize the body while moving.Connecting hip and knees.

Thus, above mentioned are three functions of femur.

For more details regarding femur, visit:

https://brainly.com/question/3264785

#SPJ2

Which location is least likely to experience a volcanic eruption? Α. an island hot spot, such as the island of Hawaii B. Hamilton County on the plains of central Texas с. a convergent boundary, as in the Ring of Fire D a volcanic island arc, such as the Aleutian Arc in Alaska

Answers

Answer:

i think that the answer is B. Hamilton County on the plains of central Texas i took the test

Explanation:

Hamilton County on the plains of central Texas is least likely to experience a volcanic eruption. Therefore, option (B) is correct.

What are volcanoes?

Molten rock and gases stored under the surface erupt through a volcano, generating a hill or mountain.

Active, inactive, or extinct volcanoes. Active volcanoes are likely to erupt again. Dormant volcanoes may erupt again. Extinct volcanoes won't erupt.Magma collects inside active volcanoes. The magma chamber's pressure forces it through rock channels and onto the planet's surface.

Volcanic eruptions can be violent or slow-moving. Volcanoes erupt through vents on the sides or a primary entrance at the top. The volcano's morphology depends on eruption rate and magma chemistry. Land and sea volcanoes exist. As lava cools and hardens, underwater volcanoes build mountains and ranges. When volcanoes rise above the ocean, they create islands.

Learn more about volcano, here:

https://brainly.com/question/18058649

#SPJ5

what type of molecule do plant cells use for long term energy storage

Answers

Answer:

ATP

Explanation:

In plants, energy is stored in the form of ATP and NADPH. Energy is produced in the presence of light it is in the thylakoids and mitochondria.

ATP: Adenosine triphosphate

NADPH:  nicotinamide adenine dinucleotide phosphate hydrogen

In the quest to understand the basis of infertility in humans, researchers have identified a mutation in a gene associated with chiasmata. This protein normally acts to promote homologous recombination.Why might a defect in homologous recombination have consequences for fertility?A. The chiasmata halts the whole process of meiosis, if crossover do not form properly.B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregationC. A checkpoint requires a certain level of genetic variability for meiosis to proceed.D. Chiasmata are the connections between the centromeres and the centromeres that pull them to each pole of the daughter cells.

Answers

Answer:

B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregation

Explanation:

Crossing-over is a unique phenomenon that occurs in the prophase I stage of meiosis I, where non-sister chromatids of homologous chromosomes exchange their chromosomal segment. The physical point where this exchange occurs is called CHIASMATA. Hence, a mutation that affects the gene associated with the chiasmata will affect the occurrence of crossing over or homologous recombination.

Crossing-over, through the formation of the chiasmata, is responsible for the physical alignment and proper segregation of chromosomes into gametes. Naturally, the chiasmata formed as a result of recombination during meiosis helps ensure that the chromosomes stay together until it is the right time to separate. This way, any chromosomal defect in the resulting gamete is prevented.

However, an error or defect in homologous recombination might give rise to gametes with chromosomal disorder, a condition known as ANEUPLOIDY i.e. missing or additional chromosomes in gametes. This can affect the fertility of the involved human.

1. A star is 520 light years from Earth. During what event in history did the
light now arriving at Earth leave the star?

Answers

Answer:

A light year is the distance which is equal to 9,460,730,472,580.8 km, so:  

= 4.91957985 X [tex]10^{15}[/tex]km  

which is distance travels by the light.  Now what time it takes light to travel distance we found.  

A year has 365.25 days, so,

[tex]1 (\frac{365.25)}{1 year}) (\frac{24}{1 day}) (\frac{3600 s}{1 hr} )[/tex] = 31557600 seg/year

The light speed in the space is equal to 299,792.458 km/s, so:  

4.91957985 x [tex]10^{15} (\frac{1 seg}{29792.458}) \frac{1 year}{31557600}[/tex] = 520 years

if today, August, 2020, then

2020 - 520 = 1500

Spanish and Portuguese spread out over the southern part of the Western Hemisphere and bring in America brought to Spanish colony of Santo Domingo in year 1500.

Therefore, during the  period 1499 AD Columbus discovered JamaicaA light-year is a distance traveled by light in space during a period of one year from a celestial object to another celestial object. The distance between stars and Earth is 520 light-years. So, the light leaving the star is 520 years ago. The present year is 2019. Light from the star left 520 years ago. The time period on Earth is,

[tex]t=2019-520\\ t=1499 AD[/tex]

Learn More:https://brainly.com/question/8244352

Question 3 (1 point)
During DNA replication, one of the new strands of DNA is synthesized continuously.
The other strand is synthesized as a number of separate fragments of DNA that are
subsequently linked by DNA ligase. Why does this occur?

- RNA primers only anneal to one of the parental strands of DNA.

- DNA polymerase III only synthesizes DNA in the 3' - 5' direction.

- DNA polymerase III only synthesizes DNA in the 5'-3' direction.

- One of the parental strands is unwound slower than the other by helicase.

Answers

Answer:

DNA polymerase III only synthesizes DNA in the 5'-3' direction.

Explanation:

DNA replication is an important phenomenon for every living cell. It is the process whereby the double-stranded DNA is doubled to form two new separate double strands. In order for DNA replication to occur, the double strand of the DNA molecule must first be unwound by an enzyme called DNA HELICASE. This gives two separate single strands, which individually acts as a template for the newly synthesized strands.

DNA polymerase III is the enzyme responsible for synthesizing new DNA strand by pairing complementary nucleotides to the old strands it attaches to. However, one of the old strands called LEADING STRAND runs in the 3'-5' direction while the other strand called LAGGING STRAND runs in the 5'-3' direction.

DNA polymerase III only attaches to the 3' hydroxyll end of the DNA and synthesizes new strand of DNA in the 5'-3' direction. Since the lagging strand runs in 5'-3', it is synthesized in small separate fragments called OKAZAKI FRAGMENTS which are later joined together by an enzyme called LIGASE.

N.B: As DNA polymerase synthesizes DNA strand on the leading strand(5'-3'), it is moving in an opposite direction of the lagging strand. Hence, it has to detach and come back to synthesize on the lagging strand. This causes the lagging strand to be synthesized discontinuously.

Which is incorrect descriptions of the genetic event initiated by the HIV reverse transcriptase (RT) upon the HIV infection?
a. RT catalyzes initial synthesis of ssDNA using viral genomic RNA as the template.
b. The first RNA template is degraded after ssDNA synthesis.
c. The whole process is completed after synthesis of dsDNA.
d. tRNAs are adopted as the first primers.
e. None of these

Answers

Answer:

e. None of these

Explanation:

The immune deficiency viruses (HIV) are retroviruses that use a reverse transcriptase (RT) enzyme to produce a single-stranded DNA (ssDNA) from an RNA template. The reverse transcription allows retroviruses to replicate their genetic material, which is integrated into the host's genome as a double-stranded linear DNA molecule in a similar way to the mechanism of insertion used by endogenous retrotransposons. The synthesis of DNA is started by cellular tRNAs (tRNA3Lys) that are packaged into the virion. After reverse transcription, the HIV DNA enters the nucleus of CD4 immune cells (also known as CD4+ T cells), and then it integrates into the genome to coopt the host's cell machinery for its own replication.

Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin. What kind of a cell is this?

Answers

Answer:

An animal cell in the telophase

Explanation:

Telophase is one of the stages of cell division in animal cell .

In the animal cell during telophase, Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin because the nuclear membrane and nucleoli reform, cytokinesis is almost coming to completion and the chromosomes eventually uncoil to chromatin. Usually cytokinesis occurs during telophase.

According to kirk smith a professor of environmental health at the university of california berkley indoor fires increase risks of pneumonia tuberculosis lung cancer and low birth weight in babies born of women expose during pregnancy. What simple solution is being widely promoted to reduce the risk of death?
a) preparing meals using solar cookers.
b) switching from wood to burning crop waste as a fuel source.
c) adding more windows to houses as a source of ventilation.
d) passing a green tax to make homeowners pay for their pollution.
e) providing asthma inhalers to children under the age of 12 years.

Answers

Answer:

preparing meals using solar cookers.

Explanation:

solar cookers  radiates at low rates.Therefore the most of the nutrients in the foods are conserved.Thus most micro nutrients for biochemical activities are retained. Vitamins which can not withstand high temperature are preserved.

Most importantly carcinogens which are usually associated with high heat foods are avoided ,when cook with low heat of solar cookers

The solar cooker is smoke free,therefore irritation of the lungs,lung cancer associated with high heat  cookers is avoided.

Specifically,local Mayan women exposed to high heat smoke cookers, suffers lung cancer,and those with pregnancy gives to infants with low birth weights. Children exposed to theses high heat also experienced acute lower respiratory infections.

Thus the smokeless,low heat solar cooker is safer.

what is sexual reproduction

Answers

Answer:

See explanation below...

Explanation:

Sexual reproduction is a type of reproduction that involves a complex life cycle in which a gamete with a single set of chromosomes combines with another to produce an organism composed of cells with two sets of chromosomes.

Best Regards!

Answer:

the production of new living organisms by combining genetic information from two individuals of different types (sexes). In most higher organisms, one sex (male) produces a small motile gamete which travels to fuse with a larger stationary gamete produced by the other (female).

Mitotic cell division creates identical copies by replicating a cell's DNA __________ and then dividing ____________.

Answers

Answer:

Mitotic cell division creates identical copies by replicating a cell's DNA once and then dividing once.

The basal side of epithelium is always connected to?
A) basement membranes
B) connective tissue
C) epithelial cells
D) blood vessels

Answers

Answer:

Basement membranes

Explanation:

Saguaro cacti are very tall cylindrical plants that usually have two L-shaped arms, one on each side. Suppose you lived in southern Arizona where the Saguaro cactus is common and you happen to have one growing in your yard. Your Saguaro has two arms but one is longer than the other. Now, assume that arm length in these cacti are controlled by a single gene with arms of the same length (A) being dominant to arms of different lengths. What is the genotype of your cactus

Answers

Answer:

The genotype is aa. Sorry if I am wrong.

Explanation:

I put the answer in the wrong spot xD

Other Questions
Determine whether the statement (p(pq))q is a tautology one time by using truth table and the other time without using truth table Julie read To Kill a Mockingbird and Romeo and Juliet, the assigned literature for English and decided to write a shortnarrative with a theme related to parental influence on children's lives.Read the excerpt and answer the question. Click here to read Julie's "To the BeachStay tuned to this station for further reports that will update listeners to possible locations for this weathersystem's landfallWhich edit would avoid repetition and make this sentence easier to understand?This weather system has the possibility of coming ashore in several locations so keep listening to this station's weather reports forfurther updatesHow close this weather system will come to our Texas coast is uncertain so keep listening to this station for further reports, includingupdatesWhether or not this weather system comes ashore along the Texas coast is yet to be reported. so stay tuned to this station for furtherreportsKeep listening to this station for updated reports about where this weather system will possibly come ashore.Im y=k/x, x is halved.what happens to the value of y The number of times a player has golfed in one's lifetime is compared to the number of strokes it takes the player to complete 18 holes. The correlation coefficient relating the two variables is -0.26. Which best describes the strength of the correlation and what is true about the causation between the variables? What is the main Difference between the United States and Great Britain with regard to how power is held? Alexander has been accepted as a freshman at a college two hundred miles from his home for the fall semester. Alexander's wealthy uncle, Michael, decides to give Alexander a car for Christmas. In November, Michael makes a contract with Jackson Auto Sales to purchase a new car for $18,000 to be delivered to Alexander just before the Christmas holidays, in mid-December. The title to the car is to be in Alexander's name. Michael pays the full purchase price, calls Alexander and tells him about the gift, and takes off for a six-month vacation in Europe. Is Alexander an intended third party beneficiary of the contract between Michael and Jackson Auto Sales HELP ASAP ROCKY!!! will get branliest. A coin is flipped eight times where each flip comes up either heads or tails. How many possible outcomes a) are there in total In the Gospel of Mark there is only one quote from the Old Testament and a marked absence of references to the law of Moses.a. Trueb. False choose the answer based on the most efficient method. if the first step in the equation " -9 + x = 5x - 7" is subtract x, what should the next step be Explain the structure and language of the two love poems and how the lyrical language allowed the poet to descritheir sexuality in a way that was never discussed in their culture. The perimeter of an isosceles triangle is 32 inches. If the base is longer than half of the two other equal sides by 2 inches, find the length of all sides of this triangle.Write as a equation. A city of Punjab has a 15 percent chance of wet weather on any given day. What is the probability that it will take a week for it three wet weather on 3 separate days? Also find its Standard Deviation Test the claim that the proportion of people who own cats is significantly different than 80% at the 0.2 significance level. The null and alternative hypothesis would be:______. A. H0 : = 0.8 H 1 : 0.8 B. H0 : p 0.8 H 1 : p > 0.8 C. H0 : p = 0.8 H 1 : p 0.8 D. H0 : 0.8 H 1 : > 0.8 E. H0 : p 0.8 H 1 : p < 0.8 F. H0 : 0.8 H 1 : < 0.8 The test is:_____. a. left-tailed b. right-tailed c. two-tailed Based on a sample of 200 people, 79% owned cats.The test statistic is:______.The p-value is:_____. Based on this we:_____.A. Fail to reject the null hypothesis.B. Reject the null hypothesis. without actually calculating the cubes find the value of each of the following (-28)^3+(12)^3+(16)^3 Abby had a checkbook balance of $1,002.45. She paid $76.98 to the electric company and $254.34 to the water company. What is Abbys current checkbook balance? can someone explain mean and median to me? PLS HELP ME ANSWER THIS QUESTION I DONT UNDERSTAND IT I WILL GIVE BRAINLIST AND A THANK YOU!!!! I need help ASAP!! I have no idea how to do this and what side does it mean when it says other side??! what is the coefficient of the variable in the expression 4-3x