which is of the following are characteristics of basidiomycota?

Answers

Answer 1

Answer:

Basidiomycota are typically filamentous fungi composed of hyphae. Most species reproduce sexually with a club-shaped spore-bearing organ (basidium) that usually produces four sexual spores (basidiospores).

Explanation:

Answer 2

Answer:

2.spores produced in basidia

4.important in the food industry

6.can cause disease to plants


Related Questions

Tracey was learning about structural organization in animals. What level of structural
organization BEST describes an egg?
A. a cell
B. a tissue
C. a system
D. an organ​

Answers

Answer:

A

Explanation:

Egg cell

The level of structural organization which best describes an egg is: A. a cell.

A cell can be defined as the fundamental (basic) structural, functional, and smallest unit of life, that is typically found in all living organisms such as animals.

The structure of an egg is similar to those of cells found in living organism, which are structurally layered with various cell organelles.

An egg shell is selectively permeable because it acts as an outer membrane just like in living cells to prevent unwanted materials from going into the egg.

In conclusion, the level of structural organization in animals cells can best be describe by using an egg.

Read more: https://brainly.com/question/19559847

A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.


What is the most significant cause of cell differentiation in a multicellular organism?

A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells

Answers

Answer:

D

Explanation:

Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.

The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.

What is cell differentiation?

Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.

In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.

Read more on cell differentiation here: https://brainly.com/question/13846411

What is the role of DNA in an organism ? how is dna related to reproduction​

Answers

Answer:

DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce. 

A virus is ________ a cell.

A)bigger than
b) the same size as
C)smaller than
d)another word for

Answers

Answer:

smaller than

Explanation:

But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus

Hope this helps <3

explain how gas is compressed into liquid in a gas barrel

Answers

Explanation:

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. ... In liquids, the molecules are very near than that of gases.

Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin

Answers

I think arteries, capillaries, and hemoglobin delivers oxygen to the body. So all except veins because veins carry blood to the heart, not the body.

Which sex cell is produced in males?

Answers

Answer:

Sperm

Explanation:

Answer:

Sperm

Explanation:

Which answer choice correctly lists the flow of food through the GI tract (gastrointestinal tract) of the digestive system?

mouth-- stomach-- small intestine-- large intestine-- rectum

rectum-- large intestine--- small intestine--- stomach--- esophagus-- mouth

mouth-- esophagus-- stomach-- small intestine--- large intestine--- rectum

mouth-- stomach-- small intestine-- esophagus--- large intestine-- rectum

Answers

This is hard ........!!!!!!

Answer:

mouth--esophagus--stomach--small intestine---large intestine---rectum

Explanation:

State the three parts of the cell theory.

Answers

Answer:

The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.

1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.

Answers

Answer:

Explanation:

BY USING FOREST WISELY;

It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;

1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.

2) Those trees of the world make up of portion land species by more than forth or fifth portion.

There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as

hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth

Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.

COMMUNITY CONSERVATION;

It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.

These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.

There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as

Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.

The article 'By using Forest Wisely' can be summarised as:

People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem.

The trees produce oxygen and they made up at least a quarter of the world population.

The trees occupy the fourth or fifth portion of the land organisms.

In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die.

The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available.

Trees are required for manufacturing important materials.

The article 'Community Conservation' can be summarised as:

In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating.

The humans occupied the space to practice farming and make houses.

The population of the gorillas was disturbed and diminished.

The hunting of gorillas by poachers was also reduced.

The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife.

Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.

Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.

To know more about forest conservation, refer to the following link:

https://brainly.com/question/16505239

burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%

Answers

Answer:

B i took the test

Explanation:

Answer: D

Explanation: Only 0.04% of the atmosphere is carbon dioxide.

Drag each description to the correct type of succession.

vacant parking lot for many years

Primary succession

Secondary succession

abandoned baseball field

recently cooled lava field

rocky hill under a melted glacier

clear-cut forest

1) Intro

Done

ivity

Answers

Answer:

1) vacant parking lot for many years (secondary succession)

2) abandoned baseball field (secondary succession)

3) recently cooled lava field (primary succession)

4) rocky hill under a melted glacier (primary succession)

5) clear-cut forest (secondary succession)

Explanation:

Succession in ecology is the gradual encroachment of life on a given ecosystem.

Primary succession involve a new never-before colonized region like a new lava deposit or land hidden under glacial sheets. Secondary succession is the encroachment of life on an area formerly harboring life but had experience a disturbance like wildfire, agricultural activities, logging etc.

Answer:

PRIMARY SUCCESSION (recently cooled lava field) and (rocky hill under a melted glacier). SECONDARY SUCCESSION (vacant parking lot for many years) (abandoned baseball field) and (clear-cut forest.

Explanation:

it's correct


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Answers

The answer is DNA I know because I know

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

All living organisms are composed of what?​

Answers

All living organisms are composed of one or more cells.So, your answer would be Cell.

hope it helps!

which two technologies use reflected sound waves

Answers

Answer:

one of them is SONAR

Explanation:

Other one is megaphone

Answer: There are 3 of them that are: radar, sonar and lidar.

Explanation: I used google to answer this

Can somebody help with those 3 problems please

Answers

Answer:

first one is option A

second one option B

third is26 N

Explanation:

1.the law here is every action has an equal and opposite......

2. only unbalanced forces move objects from rest or of uniform motion

3.net force is the sum of forces ,if forces are in the same direction

hope this helps plz mark me brainliest

2) Option A.
Force is directly proportional to the mass. As the mass of the fuel deceases as the fuel is burnt, the force also decreases as force is directly proportional to mass, and as the force decreases, the acceleration decreases as acceleration is also directly proportional to the force, and the shuttle may eventually come to a stop due to the increasing deceleration. However, initially if the forces are kept balanced as the space shuttle and the gases exert an equal amount of force on each other in the directions opposite to each other, the object will keep on moving upwards in a constant velocity as the amount of force is also kept constant.


3) Option B.
The motion will definitely change when the forces acting on an object are unbalanced-it will start to move, accelerate or decelerate or change its direction in the direction of the net force. The object will not move at all or continue moving with the same velocity and in the same direction if the forces acting on it are balanced or zero.

4) When the forces are unbalanced and are acting on an object in the same direction, the net force will be found by finding the sum of those forces.
Net force=17+9=26 N.

I really, really hope this helps! And please mark it as brainliest.

Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball

Answers

Answer:

Kicking a soccer ball

Explanation:

Answer:

Kicking a soccer ball

Explanation:because moving blood and having a heartbeat arent in need of a skeletal system

Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. What would happen to an ecosystem if this process was compromised?
A.
The population of green plants in the ecosystem would increase.
B.
There would be more energy available to consumers in the ecosystem.
C.
The soil quality of the ecosystem would dramatically improve.
D.
The carrying capacity of the ecosystem would be limited.

Answers

Answer: D

Explanation:

Since the Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. They end up playing a vital role in the ecosystem, if this were to be compromised nothing good would come form it Disease, competition, predator-prey interaction, resource use and the number of populations in an ecosystem all affect carrying capacity. If Earthworms, small insects, and microorganisms couldn't break down the the dead material and return it to the soil, then surely the carrying capacity would be drastically effected.

Please help out! It would be very nice !!

Answers

Answer:D

Explanation:

Cell wall provides structure and protection

Answer:

D is the answer to the question

DNA is a molecule that stores____information in the cells

Answers

Answer: instructions

Explanation: trust me

Answer:

genetic

Explanation:

Biogeochemical cycles _______.

Answers

Answer:a biogeochemical cycle or substance turnover or cycling of substances is a pathway by which a chemical substance moves through biotic (biosphere) and abiotic (lithosphere, atmosphere, and hydrosphere) compartments of Earth.

Explanation:

A biogeochemical cycle is one of several natural cycles, in which conserved matter moves through the biotic and abiotic parts of an ecosystem

WILL MARK BRAINIEST!!!! PLZ!!!
Which system of equations is equivalent to the following system?

4x + y = 4
2x + 7y = 28

4x + y = 4
−2x − 7y = 28
4x + y = 4
−8x − 28y = 112
−28x − 7y = −28
2x + 7y = 28
−8x − 2y = 8
2x + 7y = 28

Answers

Answer:

D.

Explanation:

Answer:

D

Explanation:

The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.

Answers

Answer:

Stabilizing Variation.

Explanation:

This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.

Organisms with varied or specific  traits within the population are selected against by the selection pressure,  with little chances of reproduction, while organisms in between, ( with least variation of  this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives  rise to narrow population  of these  particular organisms,(stabilizing variation) which are therefore naturally selected.

Therefore, the variation of the organisms in this population is kept  close to the  centre of  the same  mean value.

. Why is the carpel considered female and the stamen male?​

Answers

Answer:  A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.

Explanation:

A factory that has not followed pollution control standards has been operating in an area that did not have such a factory before. Plants that used to grow well are not doing well. Fish in a nearby river are dying at a higher rate than usual. Why?

A Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water rise.

B It hasn't rained enough and the plants aren't getting enough water.

C The factory has increased the temperature in the area.

D Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water become lower.

Answers

Answer:

D

Explanation:

If the pH levels are becoming low then the water and dirt becomes acidic killing fish and plants

What are the differences between parents and offsprings ?

Answers

Answer:

Offspring is a person's daughter(s) and or son(s); a person's child. While a parent is one of two persons from whom one is immediately biologically descended; a mother or a father.

Answer:

Parents have offspring

Explanation:

Offspring is the result of sexual or asexual reproduction by parents.


The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow

Answers

Answer: a glacier; snow; ice

Explanation:

Just did it and it was right

I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order

Answers

Answer:

please put a picture of the work you have to do so i can help you

Explanation:

A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?

A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left

Answers

Answer:

Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30

F=ma.

30=30a

a=30/30

a=1m/s^2

Glaciers pushing rocks against rocks is an example of

Answers

Answer:

Erosion??

Explanation:

Answer:

Glacial Erosion

Explanation:

Other Questions
The mk family orchard has 120 apple trees and 90 pear trees. If each fruit tree produces an average of 590 pounds of fruit per year, about how many pounds of fruit can the orchard produce in one year what is the slope of the line 7x+2y=5 You work at a cheeseburger restaurant. Write a program that determines appropriate changes to a food order based on the users dietary restrictions. Prompt the user for their dietary restrictions: vegetarian, lactose intolerant, or none. Then using if statements and else statements, print the cook a message describing how they should modify the order. The following messages should be used: - If the user enters "lactose intolerant", say "No cheese." - If the user enters "vegetarian", say "Veggie burger." - If the user enters "none", say "No alterations." Which of the following is equivalent to the complex number i8?Choose 1 answer:mi1-1plStuck? Watch a video or use a hint.Report a problem What is a purine and a pyrimidine? Name them. Please help if you can Static electricity isa closed conducting pathwhen electrons move easily through objectsbuild up of electrical charges by friction Identify the italicized figure of speech. When I consider how my light is spent, E're half my days, in this dark world and wide, And that one Talent which is death to hide, Lodg'd with me useless, though my Soul more bent To serve therewith my Maker, and present [ 5 ] My true account, least he returning chide, Doth God exact day labour, light deny'd, I fondly ask; But patience to prevent That murmur, soon replies, God doth not need Either man's work or his own gifts, who best [ 10 ] Bear his milde yoak, they serve him best, his State Is Kingly. Thousands at his bidding speed And post o're Land and Ocean without rest: They also serve who only stand and waite. choices metonymy understatement hyperbole Farmer Bob's daughter wanted to put carpet in her goats pen. The pen is 12 feet wide and 12 feet long. How many square feet of carpet does she need for the pen 10. Which of the following pieces of safety equipment is required on your boat and must appear as an item on your Pre-DepartureChecklist?A reflective mirror surfaceA waterproof compassExtra clothes and towelsWorking navigation lights what two factors does elastic potential energy depend upon Simplify 17 1/2 - (-9 3/8)ASAP please extra poonts Make questions and negative sentences Example You speak EnglishQuestion: Do you speak English?Negative. You dont speak English1. They play tennis.Question: Negative: 2. Ramn likes pizza.Question: Negative: 3 My best friend works in a hotel.Question: Negative: 4. My parents get up early.Question: Negative: 5. We like your house.Question: Negative: 6. I study English.Question: Negative: 7. My friend lives in Paris.Question: Cardiac muscle causes movement in the A football team has P points.P = 3W + DW is the number of winsD is the number of drawsIf a team has 53 points from 33 games, with 11 draws, how many games did the team lose Help me please. Im giving 20 pointsBrenda is playing hide-and-seek with Cody and Lara. Cody is hiding 16 meterssouth of Brenda, and Lara is hiding due east of Cody. If Brenda is 20 meters fromLara, how far apart are Cody and Lara? As the kinetic energy of particles of matter increase, the distance between the particles? Givin away points if ur a begginer The CFOs objective is to make certain that the capital consumed in farming is renewed and that the farm remains efficient, utilizing the best technology and equipment appropriate for its competitive situation. How would you expect the CFO to calculate depreciation expense? Donnell backed up the information on his computer every week on a flash drive. Before copying the files to the flash drive, he always ran a virus scan against the files to ensure that no viruses were being copied to the flash drive. He bought a new computer and inserted the flash drive so that he could transfer his files onto the new computer. He got a message on the new computer that the flash drive was corrupted and unreadable; the information on the flash drive cannot be retrieved. Assuming that the flash drive is not carrying a virus, which of the following does this situation reflect? a. Compromise of the security of the information on the flash drive b. Risk of a potential breach in the integrity of the data on the flash drive c. Both of the above d. Neither of the above.