Which is represented by the image?

Answers

Answer 1

Answer:

represent by image.

Explanation:

To store an image on a computer, the image is broken down into tiny elements called pixels. A pixel (short for picture element) represents one colour. ... In order for the computer to store the image, each pixel is represented by a binary value. We call this representation of colours a “bit-plane”.


Related Questions

What has a greater influence on protein levels? A. Protein degradation has a greater influence because they are denatured faster than the cell can produce them B. mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced C. mRNA destroyer concentration has a greater influence because mRNA is destroyed right after the proteins are produced D. Protein degradation has a greater influence because outside factors like antibiotics can cause it, and it is difficult to recover from

Answers

Answer: b

Explanation: i got the answer wrong and i’m looking at the results rn

Protein is being produced with the help of a process called translation in which mRNA gets translated to produce proteins. The translation is followed after the process of transcription of DNA to RNA.

The cause of the greater influence of protein levels has defined as follows:

The destruction of mRNA could greatly influence protein levels as mRNA is considered the source for proteins to get synthesized. This is because if mRNA gets destroyed, proteins would not have been produced at all. Thus, directly influences the levels of protein.

Thus, we can conclude that mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced. Hence, option (b) is the correct answer.

Learn more about protein here:

https://brainly.com/question/22241855

Los cuyes del pelo crespo, al ser cruzados con cuyes de pelo liso, producen solamente cuyes de pelo crespo, si se cruza uno de los cuyes de pelo crespo de F1 con el homocigoto recesivo. ¿Qué proporciones es posible esperar

Answers

Answer and Explanation:

Datos:

El alelo dominante del gen que codifica para el tipo de pelo, determina el pelo crespo. Llamemos P al alelo dominante. Genotipos que expresan pelo crespo: PP (Homocigota dominante) y Pp (Heterocigota)El alelo recesivo del gen que codifica para el tipo de pelo determina el pelo liso. p es el alelo recesivo.Genotipo homocigota recesivo, pp, expresa pelo liso.La cruza entre un cuy de pelo crespo y un cuy de pelo liso producen solo cuyes de pelo crespo. Esto implica que el parental con pelo crespo era homocigota dominante.

1º Cruza: un cuy de pelo crespo y un cuy de pelo liso

Parental)  PP    x    pp

Gametas) P   P      p   p

Cuadro de Punnet)      P          P

                             p     Pp       Pp

                             p     Pp       Pp

F1) 100 % de la progenie posee pelo crespo

     4/4 tienen genotipo heterocigoto.

2º Cruza: un cuy heterocigoto de la F1 y un cuy homocigoto recesivo

Parental)   Pp      x       pp

Gametas) P    p        p     p

Cuadro de Punnet)     P         p

                          p    Pp        pp

                          p    Pp        pp

F2)   50% de la progenie tiene pelo crespo

       50% de la progenie tiene pelo liso

       2/4=1/2 de la progenie es heterocigota

       2/4 = 1/2 de la progenie es homocigota recesiva.

what is the answer to 9k=27

Answers

Answer:

K=3

Explanation:

We divide both sides by 9 which is 9k/9=27/9 then cancel 9 by 9 and by 9 once by 9 thrice.

What is conjunctivitis

Answers

Answer:

[tex] \underline{ \underline \orange{see \: below}}[/tex]

Explanation:

Conjunctivitis is an inflammation, infection of the conjunctiva. It is the most common ocular disease worldwide.It is characterized by a pink appearance because of subconjuctival blood vessels hemorrhage.

Simply, we can define it as :

Conjunctivitis ( pink eye ) is an inflammation or infection of the transparent membrane ( conjunctiva ) that lines your eyelid and covers the white part of your eyeball.

Pink eye is commonly caused by a bacterial or viral infection , an allergic reaction or in babies.

The most common pink eye symptoms include:

Redness in one or both eyesItchiness in one or both eyesA gritty feeling in one or both eyes

Hope I helped !

Best regards!

Examine the statement. A scientific theory can become a scientific law, but a scientific law cannot become a scientific theory. If the statement is true, select “True.” If it is false, select the option that is true 1.) True 2.) A scientific theory can become a scientific law, and a scientific law can become a scientific theory. 3.) A scientific law can become a scientific theory, but a scientific theory cannot become a scientific law. 4.) A scientific theory cannot become a scientific law, and a scientific law cannot become a scientific theory.

Answers

Answer:

It's true.

Explanation:

In general, a scientific law is the description of an observed phenomenon. It doesn't explain why the phenomenon exists or what causes it. The explanation of a phenomenon is called a scientific theory. It is a misconception that theories turn into laws with enough research.

When the scientists test the idea, they develop a theory by following a set of logical steps. A theory becomes a scientific law once it has been rigorously examined and accepted. Thus, option A is correct.

What A scientific theory can become a scientific law?

One prevalent fallacy is the idea that hypotheses eventually become laws. Despite the number of supporting examples, hypotheses do not actually become laws after repeated testing.

Scientific laws, like theories, explain occurrences that the scientific community has determined to be verifiably true. In general, laws explain what will occur in a specific circumstance and are proven by a mathematical equation, whereas theories explain how the phenomenon occurs.

Therefore, A testable explanation of a natural event is what constitutes a scientific hypothesis. The concept of gravity, for instance, explains why an apple always falls to the ground when.

Learn more about scientific theory here:

https://brainly.com/question/2375277

#SPJ2

Which label in the graphic represents the energy that is released from glucose by cellular respiration?
Oxygen
Glucose
Energy stored as ATP
Carbon dioxide and water

Answers

Answer:

C) Energy stored as ATP

Explanation:

100% on edge

Identify the error in the following statement: “Photosynthesis is a chemical
reaction that takes place in the chloroplasts of green plant cells, where chemical
energy is used to convert carbon dioxide and water into glucose and oxygen."
A. No errors
B. "water" and "oxygen" should be switched
C. "chemical" should be "light"
D. "chloroplasts" should be "mitochondria"

Answers

Answer:

It is 'C'

Explanation:

The chemical reaction that occurs in the chloroplast is:

6CO₂ + 6H₂O → C6H₁₂O₆ + 6O₂

The electromagnetic energy of sunlight is converted to chemical energy in the chlorophyll-containing cells of photosynthetic organisms. The granum stores the photon particles from light and converts its energy into chemical energy to convert carbon and water into glucose and oxygen.

Answer:

c

Explanation:

2. What happens in
terms of energy
when you hold a
craft stick and bend
it slightly?

Answers

Answer:

In a similar way a wooden tongue-depressor stick (like the kind used at the doctor's office) stores elastic potential energy when you bend it (though not if you break it). ... The elastic potential energy that was stored in the stick is transformed into movement, called kinetic energy.

Explanation:

how do i explain this?

Answers

Answer:

Oxygen debt is a physiological phenomenon in which a person consume oxygen at fater rate that it replaced by new oxygen molecules.

As shown in the graph, oxygen debt occurs just after the end of exercise because oxygen is consumed at faster rate during exercise that leads to  increased respiration and body attempts to replace the used oxygen.

To overcome the problem of oxygen debt, a person should take rest that allows the body to replenish its oxygen supply.

If Earth’s average surface temperature continues to change over the next 30 years at the same rate it changed between 1980 and 2010, the average temperature will most likely be around

Answers

Answer:

Its B....

Explanation:

Get that 100.

algae's general habitat?

Answers

Answer:

Algae is the process to describe that diverse group of photosynthetic lifeforms.

Explanation:

Algae is that environments process to the rivers and lakes to ponds waters an snow, algae living in the contain snow pigments that addition to the surrounding contain distinctive.

Algae is environment near inside water bodies, algae in many components in plants as stems and shoots or leaves nutrients water their body.

Algae like plants an special structure and algae is well defined body in the structure stems and leaves are photosynthetic organisms, algae are free living and symbolic relationship other organisms, there are many types of algae:- Green algae, blue and green algae ,red algae.

Green algae:- green algae to that conduct photosynthesis symbolic relation with higher organisms.

Blue and green algae:- this algae are include dams, river, lakes.

Red algae:- red algae is used in species found in freshwater ecosystem.

Algae is in unicellular and multicellular in environment nature.

Which describes a grizzly bear’s habitat? all the biotic factors in the ecosystem all the abiotic factors in the ecosystem the role of the bear in the ecosystem the physical area where the bear lives

Answers

Answer:

it is D

Explanation:

A grizzly bear’s habitat comprises of the physical area where the bear lives

What is a habitat?

A habitat is defined as the dwelling home of living organisms.

There are three major types of habitat; namely:

Terrestrial habitatAquatic habitatArboreal habitat

Terrestrial habitat is the land habitatAquatic habitat is the water habitatArboreal habitat is the tree habitat

Learn more about habitat:

https://brainly.com/question/25832580

Which type of chromosomal disorders seems to have the greatest affect on a person’s health—disorders involving autosomes or sex chromosomes? Why do you think this might be the case? thanks in advance

Answers

Answer:

Disorders involving sex chromosomes.

we can take Turner's syndrome n klinefelter's syndrome as examples.

Cómo explicarías tu que el soporte vegetal es más importante que los animales en un ecosistema?

Answers

Answer:

Las plantas son productores primarios, mientras que los animales son consumidores

Explanation:

La cadena alimenticia está conformada por niveles tróficos donde la energía fluye desde los niveles basales representados por la base de la pirámide, hasta los niveles superiores (pico de la pirámide). De este modo, los organismos representan diferentes eslabones de acuerdo a su posición en la cadena alimenticia. En el primer nivel se encuentran los productores primarios como lo son, por ejemplo, las plantas y algas de ambientes terrestres y acuáticos, respectivamente, siguiendo por los consumidores primarios (por ejemplo, especies hervívoras), continuando sucesivamente por los consumidores secundarios, terciarios y cuaternarios (especies carnívoras), los cuales se encuentran en posiciones cada vez más altas de la pirámide. No obstante, es importante indicar que existen ocasiones donde los consumidores superiores (ya sea secundarios, terciarios y cuaternarios) se alimentan de especies situadas por debajo de diferentes niveles no consecutivos e incluso también de especies pertenecientes al mismo nivel trófico, con lo cual encajando en más de una categoría y dificultando su clasificación en la cadena.

The removal of waste products from the body is called

Answers

Answer:

It is called EXCRETION.

Explanation:

This is a process by which metabolic waste is removed from a living organism.

The excretory organs removes these waste.

Accumulation of these in the body is very harmful to our system.

Hope all these helps.

What will happen if external factors affect cell division in a group of cells placed in a culture dish? A) Anchorage dependence will cause the cells to attach to each other after dividing. B) Anchorage dependence will prevent the cells from dividing until they attach to the dish. C) Density-dependent inhibition will cause the cells to divide until the dish is completely full. D) Density-dependent inhibition will destroy large cells to create room for new cells.

Answers

Answer:

C) density-dependent inhibition will cause the cells to divide until the dish is completely full

Explanation:

Just took the exam

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

6. Which type of seismic wave is highlighted in the image?
O A. P wave
B. S wave
O C. Love wave
D. Rayleigh wave

Answers

Answer:

Rayleigh wave

Explanation:

Rayleigh waves are a type of surface acoustic wave that travel along the surface of solids. They can be produced in materials in many ways, such as by a localized impact or by piezo-electric transduction, and are frequently used in non-destructive testing for detecting defects.

hope it helps :)

please mark it the brainliest!

Rayleigh wave, surface acoustic waves called Rayleigh waves move along the surface of solids, hence option D is correct.

What is seismic wave?

They are commonly employed in non-destructive testing to find flaws and can be created in materials in a variety of methods, as by a localized impact or by piezoelectric transduction.

These include what are known as Rayleigh waves. A Rayleigh wave's amplitude decreases with depth below the surface and becomes noticeably tiny at depths greater than a few wavelengths.

As a result, the disturbance is limited to a solid's surface layers. The motion experienced by the surface layers includes both transverse and longitudinal components.

Therefore, Rayleigh wave type of seismic wave is highlighted in the image.

Learn more about seismic wave, here:

https://brainly.com/question/12651581

#SPJ5

Please help!

A. I only

B. II only

C. III only

D. I and III only

Answers

Answer:

a

Explanation:

my reason is that the capacity carrying is 35

Answer:

[tex]\boxed{\mathrm{A. \: I \ only}}[/tex]

Explanation:

The graph does not mention any seasons. The graph is not growing geometrically. For about 9 months the population has been about 35.

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

In CaF2, the oxidation number of Ca is , and that of F is . In H2SO4, the oxidation number of H is , that of S is , and that of O is . In CaSO4, the oxidation number of Ca is , that of S is , and that of O is . In HF, the oxidation number of H is , and that of F is

Answers

Answer:

1. The oxidation number of Ca is 2, F is -1 in CaF₂

2. The oxidation number of H is 2, S is 6, O is -8 in H₂SO₄

3. The oxidation number of Ca is 2, S is 6, O is -8 in CaSO₄

4. The oxidation number of H is 1, F is -1 in HF

Explanation:

To get the oxidation number, we need to take the oxidation number of the whole compound 0. Then we need to know the oxidation number of the other elements and we need to take 'x' as the oxidation number of the unknown element.

Example:

In case of CaSO₄,

We can write an equation as-

CaSO₄ = 0

If we need to know the oxidation number of S

We can write the equation like this-

→2+ x+ (-2*4) = 0 (as we know the oxidation number of Ca is 2 as it has two electrons in its last shell which it gives to other elements to form bonds and the oxidation number of O is -2 as it takes 2 electrons to complete its outer shell)

→2+ x+ (-8) = 0

→2+ x- 8 = 0

→x- 6 = 0

→x = 6; which is the oxidation number of S

                       

The following are the oxidation numbers:

In CaF2, the oxidation number of Ca is +2, and that of F is -1.

In H2SO4, the oxidation number of H is +1, that of S is +6, and that of O is -2.

In CaSO4, the oxidation number of Ca is +2, that of S is +6, and that of O is -2.

In HF, the oxidation number of H is +1, and that of F is -1.

What is oxidation number?

Oxidation numbers are a way of representing the degree of oxidation (loss of electrons) or reduction (gain of electrons) of an element in a chemical compound. The oxidation number of an element is calculated based on the number of valence electrons (electrons in the outermost energy level of an atom) and the rules for assigning oxidation numbers.

In general, the oxidation number of an element is equal to the charge it would have if all the bonds in the compound were ionic (made up of positive and negative ions). This allows chemists to predict the behavior of elements in a compound and to balance chemical equations.

Learn more about oxidation number, here:

https://brainly.com/question/29257381

#SPJ2

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

3. Why are some potentially
renewable resources currently
nonrenewable resources?

Answers

Some potentially renewable resources are currently nonrenewable because... species are taken faster than they can reproduce.

Why might an ecosystem be better able to
cope with a season of forest tent caterpillar
outbreak than an increase in acidic
precipitation?

Answers

Answer: It contains leach aluminium.

Explanation:The ecological effect of acid rain are most Clearly seen in aquatic environment such as, stream, lakes and marshe where it can be harmful to fish and other wildlifes.

On May 18, 1980, Mount St. Helens in Washington State experienced a huge volcanic eruption after a magnitude 5.1 earthquake. During the eruption, hot ash and pumice poured down the west, south, and east sides of the mountain, melting the snow and ice at the top of the volcano and producing volcanic mudflows. Which type of process first occurred in the ecosystem around Mount St. Helens after it erupted?
primary succession
secondary succession
a climax community
species extinction

Answers

Answer:

Primary succession

Explanation:

Primary succession is mostly cause by volcanic eruption

The first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

What is a primary succession?

The term primary succession refers to the organisms that first occur in an ecosystem after a major event such as the volcanic eruption has taken place.

In this case, the first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

Learn more about primary succession: https://brainly.com/question/26675203

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything

Answers

The question is incomplete,below is the complete question.

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything?"

You tell the Clinical Nurse Specialist (CNS). As the two of you move him into the bed, you notice that his chest tube bottle is lying on its side on the gurney, with air going into it. When you point this out to the CNS, she immediately grabs the bottle and sets it upright on the floor. You see air start bubbling through the fluid right away. "That was the problem!" she says. "They lost the water seal, and air was going into his chest from the bottle. You would not believe how many times that happens on transport." When you examine Mr. B, you have trouble detecting his lung sounds on the left. Even stranger, his apical heart sound is in the wrong place - it is over toward the right side of his chest. His respiration rate and heart rate are both increased, and he is struggling to breathe. "Let's give him a little oxygen. He'll be a lot better in a half-hour," says the CNS. "Check back on him."

QUESTION - Why would accumulation of air in his pleural space cause his heart sounds to be in the wrong place?

Accumulation of air in Mr B pleural space will cause his heart sound to be heard in the wrong place because the left side is his chest is being filled up with air making the organs in his chest to to be pushed over to the right side.

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

Other Questions
Let $n$ be a positive integer. (a) Prove that \[n^3 = n + 3n(n - 1) + 6 \binom{n}{3}\]by counting the number of ordered triples $(a,b,c)$ of positive integers, where $1 \le a,$ $b,$ $c \le n,$ in two different ways. (b) Prove that \[\binom{n + 2}{3} = (1)(n) + (2)(n - 1) + (3)(n - 2) + \dots + (k)(n - k + 1) + \dots + (n)(1),\]by counting the number of subsets of $\{1, 2, 3, \dots, n + 2\}$ containing three different numbers in two different ways. A plumber (come) ____________ to our house yesterday. He (want) _____________ to repair our washing machine. While he (repair) _______________ the washing machine, I (watch) ___________________ the news. Suddenly, I (realize) ____________ that they (show) ____________________ our street on TV. The reporter said that a car had crashed into a stop sign just before reaching the crossroads. While I (listen) _________________ carefully to what had happened, someone (knock) ________________ at my door. I (open) ______________ the door and (see) ___________a police officer standing there. He (ask) ____________ for the plumber. As it (turn out) ________________, it (be) __________ our plumbers car that had rolled down the street. In haste, the plumber had forgotten to put the handbrake on. A premature infant develops jaundice. Laboratory test results are negative for hemolytic disease of the newborn, but the infants bilirubin level continues to rise. Abnormal urinalysis test results include a dark yellow color, positive Ictotest, and needle-shaped crystals seen on microscopic examination. What is the most probable cause of the infants jaundice? _____consists of 6 different dimensions-physical, emotional, intellectual, spiritual, social, and environmental. A. Health B. Wellness C. Risk Factors D. Diseases Which statement is always true when describing sex-linked inheritance? It results in a dominant trait. The alleles are found on the X or Y chromosome. The resulting trait is influenced by multiple alleles. It is affected by alleles on at least three different chromosomes. Subjects and verbs must agree in which of the following categories?(1 point) 1 singular 2 phrase 3 number 4 plural ill give brainiest first person to answer The Cutting Department at Blanc Company had beginning work in process inventory of 4,000 units, transferred out 9,000 units, and had 2,000 units in ending work in process inventory. The number of units started into production by the Cutting Department during the month is In one paragraph, explain why leaders of the women's rights movement decided to model the Declaration of Sentiments after the Declaration of Independence. Power +, Inc. produces AA batteries used in remote-controlled toy cars. The mean life of these batteries follows the normal probability distribution with a mean of 35.0 hours and a standard deviation of 5.5 hours. As a part of its quality assurance program, Power +, Inc. tests samples of 25 batteries.A) What can you say about the shape of the distribution of the sample mean? B) What is the standard error of the distribution of the sample mean? C) What proportion of the samples will have a mean useful life of more than 36 hours? D) What proportion of the sample will have a mean useful life greater than 34.5 hours? E) What proportion of the sample will have a mean useful life between 34.5 and 36.0 hours? hat change is needed to form a complete sentence below? Every year we plant trees near the school. Question 1 options: a) Add a semicolon after Every year b) Change Every to Once a c) Add in the spring after school d) No changes need to be made. Which statement best defines an inference?O A.the details stated directly by the author of a passageKODB.a conclusion based on evidence and outside knowledgeO C.a guess that relies only on the reader's prior experiencesKD D.the background information about a literary work #Recall that input from a user is always in the form of a string. #Write a function called "input_type" that gets user input and #determines what kind of string the user entered. The user input #will be supplied as an argument to the function like normal. # # - Your function should return "integer" if the string only # contains characters 0-9. # - Your function should return "float" if the string only # contains the numbers 0-9 and at most one period. # - You should return "boolean" if the user enters "True" or # "False". # - Otherwise, you should return "string". #Write your function here! A semi-circular loop consisting of one turn of wire is place in the x-y plane. A constant magnetic field B=1.7T points along the negative z-axis(into the page), and a current I=0.7A flows counterclockwisefrom the positive z-axis. The net magnetic force on the circular section of the loop points in what direction? What is the net magnetice force on the circular section of the loop? The right of a defaulted taxpayer to recover his or her property before its sale for unpaid taxes is the: Group of answer choices statutory right of r 5. The cost of movie tickets at theCinema Verite is 9 dollars for adultsand five dollars for children under 12.During the Saturday and Sundaymatinees, adults are charged 8 dollarsfor admission and children under 12are charged 4 dollars. At any time atall, there is a group discount for groupsof 15 or more adults at a cost of 6dollars per ticket. What is the cost for 2adults and 3 children during theSaturday matinee?a. 27b. 28C. 14d. 32 g A smart phone charger delivers charge to the phone, in the form of electrons, at a rate of -0.75 C/s . Part A How many electrons are delivered to the A car is traveling on a highway. The distance (in miles) from its destination and the time (in hours) is given by the equation d = 420 minus 65 t. What is the practical meaning of the d-intercept? a. Initially the car is 355 miles from its destination. b. Initially the car is 420 miles from its destination. c. Initially the car is 65 miles from its destination. d. Initially the car is 485 miles from its destination. Product differentiation and advertising are profitable ventures only when:the market is monopolisticboth revenues and costs increasethey do not affect entry barriersthe gain in total revenue outweighs the extra costthe market is oligopolistic differentiate between regionalization and regionalism In the first quadrant you start at 5, 6 and move 4 units down. What point will you end up at? Thanks for your help! - Someone who's better at English than math