Which is the fraction for 0.21?

Answers

Answer 1

Answer:

21/100

Step-by-step explanation:

Answer 2
The fraction would be 21/100

Related Questions

Find the missing angle measures
Please help

Answers

Answer:

angle N is 64 and the bottom one is 52

Step-by-step explanation:

M and N are the same angke and they add up to 128 and all angles in a triangle add up to 180 meaning the bottom angle is 52

Answer:

N = 64 if there is another letter it would be 52

Step-by-step explanation:

I hope this helps <3

1-27
What is the simplified version of Square root of -27

Answers

Answer:

3√3

Step-by-step explanation:

Your bill at pizza hut is $30. You leave 20% tip. Whats is the amount of tip?

Answers

You gave $30.

[$30 * 0.20] (tip % amount) = $6.

You left $6 in tips.

For questions 13 - 14, determine which mappings are functions. please help, will give brainliest

Answers

Answer:

24

Step-by-step explanation:

ASAP HELP!! sorry the photo is bad it’s the lighting but please help

Answers

Answer:

3

Step-by-step explanation:

Hannah is a photographer who specializes in portraits. This morning, she soent four hours doing graduation portrait sessions. In the afternoon, she soent four hours doing family portaits sessions but she didnt do as many session as the graduation portraits. Tomorrow, she has the same number of graduation and family sessions to work. Which will she likely finish in less time?

Answers

She will likely finish the graduation sessions in less time.

PLEASE HELP THIS IS TIMED!!!! I WILL GIVE BRAINLIESTTTTTT

The table below represents a linear function f(x) and the equation represents a function g(x):

x f(x)
−1 −3
0 0
1 3
g(x)

g(x) = 7x + 2


Part A: Write a sentence to compare the slope of the two functions and show the steps you used to determine the slope of f(x) and g(x). (6 points)

Part B: Which function has a greater y-intercept? Justify your answer. (4 points)

(10 points)

Answers

Answer

Given: Sorry the images are at the bottom.

To find:

Part A: Write a sentence to compare the slope of the two functions and show the steps you used to determine the slope of f(x) and g(x).

Part B: Which function has a greater y-intercept? Justify your answer.

Solution:

On inspection of values of x and f(x) it is clear that f(x) is a linear function

i.e.

1)Slope of f(x) and y-intercept of f(x):

Convert the function in slope intercept form and calculate the slope.

Slope intercept form:

Here,

Slope of f(x)=1,

y-intercept of f(x)=(0,0)

2) Slope and y-intercept of g(x):

Slope of g(x)=7

Y-INTERCEPT of g(x) =(0,2)

Part A:

Slope of f(x) is 1 and slope of g(x) is 7.

Part B:

g(x) has a greater y-intercept.

Hope it helps you.

List the sides in order from shortest to longest. The diagram is not to scale. Triangle upper J upper K upper L is shown. Angle upper J is labeled 45 degrees. Angle upper K is labeled 57 degrees. Angle upper L is labeled 78 degrees. A. Modifying above Upper L Upper K with bar, Modifying above upper L upper J with bar, line segment JK B. line segment JK,Modifying above Upper L Upper K with bar, Modifying above upper L upper J with bar C. line segment JK,Modifying above upper L upper J with bar, Modifying above Upper L Upper K with bar D. Modifying above Upper L Upper K with bar, line segment JK, Modifying above upper L upper J with bar

Answers

Answer:

your answer would be C

Step-by-step explanation:

line segment JK,Modifying above upper L upper J with bar, Modifying above Upper L Upper K with bar

what’s the answer? i need it asap please

Answers

Answer:

D

Step-by-step explanation:

Subtract 30 and 16. Cross out 0 and make it a 10 and 10-6= 4 then take 1 from 3 and make it a 2 and 2-1=1. It will all equal up to 14!

Answer:

8x+30+4x+18=180

12x+48=180

180-48=12x

132=12x

x=132/12

x=11


In the isosceles trapezoid shown, GJ = 5 and Hi = 9. Determine the length of the
midsegment of the trapezoid.
A) 9
B) 7
C) 5
D)14

Answers

Answer:

The answer to the question provided is 7.

Answer:

b

Step-by-step explanation:

Jug A holds 1800ml Jug B hold 3/10 more. How much does jug B hold?​

Answers

Answer:

Jug B can hold 2340 ml.

Step-by-step explanation:

Given

The amount in Jug A = 1800ml

To determine

How much does jug B hold?​

Give that the Jug B holds 3/10 more, i.e.

[tex]\frac{3}{10}\times \:1800=540[/tex]

Thus,

The total amount in Jug B = 540+1800

                                           = 2340 ml

Therefore, Jug B can hold 2340 ml.

Answer:

get into it

Step-by-step explana   tion:

 

is 355.95 correct when it was 325 with 10.5% tax ?

Answers

Answer:

359.13

Step-by-step explanation:

Sales tax rate: 10.5%;

Price without tax: $325 dollars;

Amount of sales tax ≈ $34.13 dollars;

Price with sales tax ≈ $359.13 dollars;

A giant tortoise moves at a slow but steady pace. It takes
the giant tortoise 3 seconds to travel 10.5 inches.
How many inches will the tortoise travel in 1 second?

Answers

the answer should be that it will take the tortoise 1 second to travel 3.5 inches

Using the common​ denominator, what is an equivalent fraction for
​4/7 ?

Answers

It would be 8/14 or 12/21, both are equivalent

Answer:

6/7,5/7,and 1/8 I think T^T

What is the value of each variable 45 h and 9

Answers

Answer:

How many variables?

Step-by-step explanation:

Simplify algebraically ​

Answers

Answer:

600,000,000

Step-by-step explanation:

Simplify the expression.

Scientific Notation:

6 ⋅ 10 ^8

Expanded Form:

600000000

3*10³/5*10-⁶

3*10⁹/5

600000000 or you can write 6*10⁸

Is (7. - 1) a solution of y = x -8?
Yes

No

Answers

Answer:

Yes

Step-by-step explanation:

Substitute the x and y values in for x and y to check.

-1 = 7 - 8

-1 = -1

In this instance, (7, -1) is a solution of y = x - 8.

x + 3 = 0

y = 1

What is the solution of the system?

(3, 1)
(1, 3)
(1, -3)
(-3, 1)

Answers

Answer:

1 i think this is answer...

summer babysitting. She decided
to put this money in a bank that
earns a 5% simple interest rate.
How many years will it take to
double her initial deposit?
A) 10 years
B) 12 years
C) 15 years
D) 18 years
E) 20 years​

Answers

Answer: B.12 years

Step-by-step explanation:

4X + 11 < -21 graph represents

Answers

Answer:

The graph of y = 4x - 11 is translated up 8 units. Which equation represents the translated graph? f y = 4x - 19 g y = 4x - 3 h y = 12x - 11 j y = 12x - 3

Answer: x=-8.   (graph with open circle going left from -8 for khan academy)

Step-by-step explanation:   -21-11<-32

4x>-32

x<-8

The diameter of a circle measures 32 mm. What is the circumference of the circle? Use 3.14 for , and do not round your answer. Be sure to include the correct unit in your answer.​

Answers

Answer:

100.48 ft

Step-by-step explanation:

1 is 25% of what number?

Answers

Answer:

4

hope it helps.........

Answer:

1 is 25% of 4

Step-by-step explanation:

let the number be x,

so, 25% of x = 1

=》25/100 × x = 1

=》 1/4 × x = 1

=》 x = 1×4

=》 x = 4

hence the required number is 4

i hope u got it

PLEASE HELP!! Will mark brainliest, find the measure of

Answers

Answer:

[tex]m\angle BYP=42^\circ[/tex]

Step-by-step explanation:

Lines and angles

The figure shows three lines forming two angles BYP and PYH whose measures add up to 90° because it's marked as a right angle.

[tex]m\angle BYP+m\angle PYH=90^\circ[/tex]

We are given the acute angles as a function of m. thus:

5m + 98 + 2m + 48 = 90

Simplifying:

5m + 146 = 90

5m = -56

m = -56/5 = -11.2

m = -11.2°

To find the measure of angle BYP, substitute m in

5m + 98 = 5*(-11.2) + 98 = 42°

[tex]m\angle BYP=42^\circ[/tex]

what is the value of x?

Answers

Answer: The horizontal value in a pair of coordinates how far along the point is. The X Coordinate is always written first in an ordered pair of coordinate (x,y), such as (12, 5).

Step-by-step explanation: Hope This Helps :)

For a example, the value 12 is the X coordinate. And Also called Abscissa.                              

The letter "x" is often used in algebra to mean a value that is not yet known. It is called a "variable" or sometimes an "unknown".

A $300 suit is marked down by 10%. Find the sale price.
The sale price is $
(Round to the nearest dollar as needed.)

Answers

Answer:

The answer is $270

Step-by-step explanation:

1. Take the original price.

2. Divide the original price by 100 and times it by 10.

3. Move the decimal one place to the left.

4. Minus this new number from the original one.

5. This will give you the discounted value.

I hope this helped! :)

If a bus travels at 48MPH how long will it take to be able to travel 60 miles

Answers

It will take 1.25 hours

a rock is thrown into a pond from a bridge above. The path the rock follows can be modeled by the equation h = - 16t^2 +44t + 12, where t is time and h is the height of the rock. Which of the following expressions is equivalent to this expression?

Answers

Ans

Step-by-step explanation:i dont know

Rewrite in simplest terms: -2(3g-8g+8)-9g−2(3g−8g+8)−9g

Answers

Answer: 2g - 32

Step-by-step explanation:

-2 (3g - 8g + 8) - 9g - 2 (3g - 8g + 8) - 9g

First step is to use the distributive property to distribute 2.

The expression is now:

-6g + 16g - 16 - 9g - 6g + 16g - 16 - 9g

Now you put the like terms together..

-6g + 16g - 9g - 6g + 16g - 9g -16 - 16

All that is left to do is combine them!

(-6g + 16g - 9g - 6g + 16g - 9g) + (-16 - 16)

2g + (-32)

2g - 32

Hope that helped!

Find the range.

3 -9 7 -1 5 -4 2 ​

Answers

Answer: The range is 94.

Hope this helps

Anyone mind helping me? 4.5+x=11?

Answers

Move all terms not containing x to the right side of the equation.

x = 6.5

Other Questions
A mass of 630g is hung on a spring. Using Force = mass x gravity, what is the force of the mass, acting on the spring? What can you infer about the schools educational and social goals, based on Doves experiences? Someone help me match the last two to their definition Hypotonic and Isotonic help would be appreciated ** if you could explain thatd be cool but if not thats ok 0.47 100with process Mircale are u online right now I need to talk to you pls Any one watch Tokyo ghoul and angels of death ;) Attempt 1Question You see Fred, a co-worker, not following safety procedures. What would be the bestthing to do?A) nothing, as his safety is his own responsibilityB) pretend you didn't see him, but consider telling the bossC) talk to him about putting his safety at riskD) follow his example -- maybe the safety procedures are not necessary What does x stand for in math Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3 Kaden, Keith, and Kipp compete in a series of daily 3-way races. For each race, the probability that Kaden wins is 1/6, the probability that Keith wins is 1/2, and the probability that Kipp wins is 1/3. On a day that Kaden doesn't win, what is the probability that Keith beats Kipp? a file that serves as a starting point for a new document Which resource is renewable?coal oilsteelwind What is civilization? How did the Native American tribes fit into the concept of civilization? Were some tribe more civilized then others? If so, how ?(YOUR OWN WORDS 300 words pls !!! 10 POINTS) Rebeca is writing a letter to a cousin telling what her new neighbors do. Choose the statements below that best match herdescriptionsEl vecino que vive en el apartamento grande cuida los dientes de los clientes.a. l es periodista.c. l es dentista.b. l es polica.