[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]
E. NADPH
thankshope it helpspls mark as brainliestAnswer:
E
Explanation:
it enters the citric acid cycle and generates reducing equivalents in the form of NADPH
What are the factors that determine
the level of harm an introduced chemical
has on the enviroment?
PLEASE ANSWER QUICKLY
What organisms are capable of cellular respiration?
A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
The Rio Grande River separates Mexico from Texas.
What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion
Answer:
d I think or b?
Explanation:
water could cause it to form a river and spread over time
7. How does a beach mouse get its trait? The order of the process is:
A.RNA → Gene A → Protein A → Amino Acid → Fur color
B.Gene A → Amino Acid → Protein A → RNA → Fur color
C.Protein A → Amino Acid → RNA → Gene A →Fur color
D.Gene A → RNA → Amino Acid → Protein A → Fur color
E.RNA → Gene A → Amino Acid → Protein A → Fur color
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
help................
The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.
Hope this helps!
HELPPP PLEASEEE
4 ANNOTATE Use the correct terms to complete this diagram showing the reactants and
products for each chemical reaction.
Answer:
Explanation:
Photosynthesis
Reactants: Carbon dioxide and water
Products: Glucose and oxygen
Respiration
It's the opposite of photosynthesis:
Reactants: glucose and oxygen
Products: Carbon dioxide and water
what are cotyledons? & what is its use
Answer:
Cotyledon, seed leaf within the embryo of a seed. Cotyledons help supply the nutrition a plant embryo needs to germinate and become established as a photosynthetic organism and may themselves be a source of nutritional reserves or may aid the embryo in metabolizing nutrition stored elsewhere in the seed.
*You Can put this in your own words
If an egg cell contains 4 chromosomes, how many chromosomes would a sperm cell of the same
species contain?
a. 4, b.8, c.16
Please help i am giving away brainiliest
Describe the Lytic cycle.
No dam links
Answer: here ya go
Explanation: The lytic cycle is one of the two cycles of viral reproduction
Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.
Explanation:
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
Select the correct answer. Which statement about natural selection is true? A. Natural selection and evolution are two terms for the same phenomenon. B. Natural selection is an outdated theory to explain how evolution took place. C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce. D. Natural selection is the process by which organisms develop variation in traits, which gives them a better chance of survival.
Answer:
C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce.
Explanation:
Natural selection is an evolutional process by which species of living organisms with stronger or more beneficial traits have higher chances of survival and reproduction. In other words, it is the process by which organisms adapt and survive.
Organisms in a population are all different in their own ways. And those with characteristics or traits better suited for the environment are more likely to survive than those without. The selection prefers more beneficial traits and not wholly on the superiority of the organism. So, the survival and reproduction chance of an organism depends on the presence of traits beneficial to the environment, which is how nature selects. And in this process, those selected will dominate the population while those rejected will be reduced or even die.
Thus, the correct answer is option C.
What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!
Answer:
decomposers and omnivores
Explanation:
what are the differences between ligaments & tendons
2. A mouse running away from the sound of an owl's wings is
an example of the mouse's ability to
A. reproduce
B. grow and develop
C. respond to the environment
D. obtain energy
Check Answer
Answer:
C Respond to the environment
A mouse running away from the sound of an owl's wings is responding to the environment.
What are living organisms?
The organism which can breathe, reproduce and have the ability to respond to an environment are some of the characteristics of a living organism.
Reproduction is the ability of an organism which gives similar kinds of organisms. Organisms grow and develop through cell division. Cell division is of two types mitosis and meiosis. Mitosis is an equational division.
The organism can respond to the environment. Mouse running away from the sound of an owl's wing is an ability to respond environment. Different organisms can obtain energy from food sources.
Therefore, A mouse running away from the sound of an owl's wings is responding to the environment.
To learn more about sensitivity refer to the link:
https://brainly.com/question/14057226
#SPJ2
Viruses can be prevented by receiving a weakened form of the virus called a?
A)plastid
B)vaccine
C)antibiotic
D)fertilizer
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?
Answer:
After the Earth, Mars is the most habitable planet in our solar system due to several reasons:
Its soil contains water to extract
It isn’t too cold or too hot
There is enough sunlight to use solar panels
Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to
It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation
The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds
The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!
Additional info:
Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.
Searching for life on Mars
Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.
List 4 chordate characteristics.
Answer:
notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail
Explanation:
had to censor second to last word but the 4 is an a
what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?
This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?
Answer:
Carbon dioxide, water and sunlight
Answer:
water and sunlight
Explanation:
Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.
_____ Motor neurons cause muscles to contract so the body can react to the stimulus.
_____ The brain processes the information through interneurons.
_____ Interneurons transfer response information to motor neurons.
_____ Sensory neurons carry stimulus information to the brain or spinal cord.
Answer:
The correct answer is -
1 - The stimulus is received by sensory receptors.
2 - Sensory neurons carry stimulus information to the brain or spinal cord.
3 - The brain processes the information through interneurons.
4 - Interneurons transfer response information to motor neurons.
5 - Motor neurons cause muscles to contract so the body can react to the stimulus.
Explanation:
In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.
These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.
B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?
Here's li[tex]^{}[/tex]nk to the answer:
bit.[tex]^{}[/tex]ly/3tZxaCQ
Hello! could someone please do a 4 sentence quark poem
Answer:
Quark is a character in the television series Star Trek: Deep Space Nine.
Quark developed a few strong friendships during his stay on Deep Space Nine.
The Ferengi have business deals throughout the galaxy; Quark is no different.
For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.
Explanation:
The energy that powers photosynthesis comes from
A. oxygen.
B. water.
C. the sun.
D. chemicals.
Answer:
sun but am not so sure about it
The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity
Which of the following best describes natural selection?
A. organisms vary in their physical traits, and some are inherited
B. Organisms compete for food and shelter
C. organisms best suited to their environments are most likely to survive and reproduce
D. Organisms produce more offspring than can survive
