Answer:
4
Explanation:
The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection according to Darwin's (and Wallace's) theory of evolution.
Natural selectionNatural selection is the process through which populations of living organisms adapt and change.It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.In 1859, Charles Darwin set out his theory of evolution by natural selection as an explanation for adaptation and speciation.Thus, we can conclude that The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.
You can learn more about the natural selection here:
https://brainly.com/question/23929271
#SPJ2
Which of the following is a molecule with more than one element?
O Atom
O Bacteria
O Compound
Organism
Answer:
compound
Explanation:
as cited from coolgalapagos.com, "Molecules made of more than one kind of element are called compounds. A compound is formed when one kind of atom (an element) joins to at least one other kind of atom of a different element."
Taxonomic classification systems for organisms are similar to many other classification
systems. The illustration below compares the National Football League to the currently
recognized taxonomic structure.
?
?
Phylum
?
?
Family
?
Species
Professional Sports Organization
NFL
Conference
Division
Team
Office/Defense
Position
Player
1 According to the diagram, the level labeled Professional Sports Organizations is most
likely which taxonomic classification?
A Class
B Domain
C Kingdom
D Order
Answer:
Domain
Explanation:
“Professional Sports Organization” is listed at the very top, or 2 tiers above Phylum. 2 tiers above Phylum is Domain.
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
What level of organization is shown in the image
How can a person cannot taste PTC I'd both of their parents have the ability to taste PTC?
Answer:
the parents are (Tt) and each passed down the recessive allele so the child is (tt)
Explanation:
Earth science question. Please help
Answer:
answer choice 4, more rain and a steeper slope cause it to flow faster
Explanation:
What is the relationship between the rock cycle and the plate tectonics?
Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.
Explanation:
Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.
_____ Motor neurons cause muscles to contract so the body can react to the stimulus.
_____ The brain processes the information through interneurons.
_____ Interneurons transfer response information to motor neurons.
_____ Sensory neurons carry stimulus information to the brain or spinal cord.
Answer:
The correct answer is -
1 - The stimulus is received by sensory receptors.
2 - Sensory neurons carry stimulus information to the brain or spinal cord.
3 - The brain processes the information through interneurons.
4 - Interneurons transfer response information to motor neurons.
5 - Motor neurons cause muscles to contract so the body can react to the stimulus.
Explanation:
In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.
These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.
help-- multiple choice!
Biogenic sediment is made of at least 30 percent...
acidic chemicals
alkaline properties
limestone or other rock
skeletal remains
Answer:
The answer is the last one, skeletal remains
Answer: Skeletal remains
This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?
Answer:
Carbon dioxide, water and sunlight
Answer:
water and sunlight
Explanation:
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
30. Which of the following best explains why enzymes are necessary for many cellular reactions?
A. Enzymes supply the oxygen necessary for the reactions.
B. Enzymes change reactants from solid to liquids during the reactions.
C. The reactions take up too much space in the cell if the enzymes are missing.
D. The reactions are too slow to meet the needs of the cell if enzymes are missing.
Answer:
D. The reaction are too slow to meet the needs of the cell if enzymes are missing
hope it helps
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
dead cells are removed from the Dermis by phagocytosis. true or false?
The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?
Answer:
No organisms
Explanation:
This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.
PLEASE HELP I NEED HELP (Plant related / Project stuff)
Answer:
B, D, A, E, C
Explanation:
1. environmental factors
2. growth
3. adaptation
4. organism
5. genetic factors
Substance A is a gas and substance B is a liquid, They are at the same temperature why is one gas and one a liquid
Deoxyribose (sugar). Total number in image?
Answer:
Formula: C5H10O4
Molar mass: 134.13 g/mol
Solubility in water: Very soluble
Melting point: 91 °C (196 °F; 364 K)
Appearance: White solid
Classification: Pentose, Deoxy sugar
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?
How are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Answer:
I don't know
Explanation:
I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Hold on, our servers are swamped. Wait for your answer to fully load.
In protein synthesis, how many nitrogenous bases code for a single amino acid?
one
two
three
four
Answer:
C
Explanation:
EDGE 2022
3 examples of radioactive dating?
Answer:
Uranium 238
Potassium 40
Rubidium 87
Explanation:
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
Babies with very low or very high birth weight are less likely to survive. The graph shows the percentage of babies born at different weights.
A graph entitled Percentage of Babies born at Different Weights has weight in pounds on the horizontal axis, and percentage on the vertical axis. A small percentage of babies are born at the low and higher birth weights, and a greater amount are around 7 to 8 pounds.
Which statement is a valid claim that could be made using the data in the graph?
Directional selection is occurring because the graph favors an extreme.
Stabilizing selection is occurring because the average is favored.
Disruptive selection is occurring because the two extremes are favored.
Biodiversity variation is occurring because there is an increase in trait variation.
Answer:
C
Explanation:
Otherwise people wouldn’t have differences
Answer:
C!!! :))
Explanation:
I tookt the test and got it right.
How is energy produced by respiration stored
Answer:
Explanation:
Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.
Answered by the ONE & Only #QUEEN aka #DRIPPQUEENMO
Hope this helped!!!
The energy that powers photosynthesis comes from
A. oxygen.
B. water.
C. the sun.
D. chemicals.
Answer:
sun but am not so sure about it
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
Which is an example of a scientific theory?
A. On average, larger mammals sleep longer than smaller mammals.
B. If a plant receives pure water, then it will grow more than one that
receives salt water.
C. Organisms evolve over time due to changes in heritable physical
characteristics.
D. If a person takes at least one vitamin per day, then it will reduce a
person's level of tiredness.
HELP PLEASE!
Answer: Organisms evolve over time due to changes in heritable physical characteristics.
Explanation:
There are a few things to look for when distinguishing between a nonscientific theory and a valid scientific theory. One thing to consider is if there are any published literature, experimental studies, and data available to support the theory. Most scientific theories have data and information tied to them. Another factor to examine is who has developed the theory. A scientific theory will always be supported by evidence with large quantities of data and testing. An example of a scientific theory is the theory of evolution, which observes changes in heritable physical traits over time in an organism. A hypothesis might be that all organisms evolve at the same rate.
Organisms evolve over time due to changes in heritable physical characteristics is an example of a scientific theory known as evolution. Thus, option C is correct.
What is evolution?Evolution is the scientific theory that explains that "a change in the characteristics of biological populations over next generations.
According to scientists RNA is the first existing molecule on earth that replicate by itself and the process of evolution lead to advanced forms of life.
These characteristics are easily trasfered from one generation to other generation.
Therefore, Organisms evolve over time due to changes in heritable physical characteristics is an example of a scientific theory known as evolution. Thus, option C is correct.
Learn more about evolution here:
https://brainly.com/question/13492988
#SPJ2
