Which of the following is a physical property that all matter has?
a. color
b. density
c. hardness
d. shape​

Answers

Answer 1

Answer:

B. Density

Explanation:


Related Questions


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Answers

The answer is DNA I know because I know

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

A virus is ________ a cell.

A)bigger than
b) the same size as
C)smaller than
d)another word for

Answers

Answer:

smaller than

Explanation:

But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus

Hope this helps <3

The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.

Answers

Answer:

Stabilizing Variation.

Explanation:

This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.

Organisms with varied or specific  traits within the population are selected against by the selection pressure,  with little chances of reproduction, while organisms in between, ( with least variation of  this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives  rise to narrow population  of these  particular organisms,(stabilizing variation) which are therefore naturally selected.

Therefore, the variation of the organisms in this population is kept  close to the  centre of  the same  mean value.

Describe three methods used to decrease the chances that microorganisms will spoil
the food.

Answers

1. wash your food.

2. put it in the fridge.

3. Cover it up.

I'm  boredddd lol

Drying, refrigeration, and fermentation are methods used to decrease the chances that microorganisms will spoil  the food.

Food preservation are techniques or practices which prevent the growth of microorganisms and slow the oxidation of fats in foods so as to prevent spoilage.

There are different methods of food preservation. Common methods which are used are drying, refrigeration, and fermentation.

Find out more at: https://brainly.com/question/18250110

Please help out! It would be very nice !!

Answers

Answer:D

Explanation:

Cell wall provides structure and protection

Answer:

D is the answer to the question

how did darwin’s theory of evolution change the way biologists thought about classification categories

Answers

Answer:

hhh3h3h3hgegegegegeggegsgsggs

y

Explanation:

hhhhhhshshshshhdhdhdhghdhgd

Because at the time they classify by if it fly,swims,run etc but after Darwin’s theory it was study that animals evolve depending on the area

In ancient times, why would a cloudy day make it so hard to tell what time it is?

Answers

Answer:

Because celestial bodies such as the sun and stars were used to tell time, so if they were obstructed by clouds it would be hard to tell time

Which is the best evidence that two species have a common ancestor?

A:The two species have the same diet.



B:The two species live in the same habitat.



C:The two species' skeletal structures are 90% identical.



D:The two species' DNA sequences are 90% identical.

Answers

Answer:

I'd go with D.

Explanation:

Species may share similar physical features because the feature was present in a common ancestor (homologous structures). Molecular biology. DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are.

The answer should be D

Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin

Answers

I think arteries, capillaries, and hemoglobin delivers oxygen to the body. So all except veins because veins carry blood to the heart, not the body.

What is the best definition of a chromosome? Based on the picture provided above :)

Answers

Answer:

d.

Explanation:

A chromosome is a strand of DNA that is encoded with genes. In most cells, humans have 22 pairs of these chromosomes plus the two sex chromosomes (XX in females and XY in males) for a total of 46. The word chromosome was originally coined in German from the Greek words khroma, meaning color, and soma meaning body.

A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.


What is the most significant cause of cell differentiation in a multicellular organism?

A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells

Answers

Answer:

D

Explanation:

Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.

The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.

What is cell differentiation?

Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.

In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.

Read more on cell differentiation here: https://brainly.com/question/13846411


Edit: Nevermind! I figured it out!!

Use the information in the table to calculate the ages of the meteorites. The half-life of potassium-40 is 1.3 billion years.

Meteorite Initial Amount(g) Final Amount(g)

1 30 7.5

2 80 5

3 100 12.5


Use your calculations to answer the questions.


How old is meteorite 1?


How old is meteorite 2?


How old is meteorite 3?

Answers

Answer:

meteorite 1- 2.6 billion

meteorite 2- 5.2 billion

meteorite 3- 3.9 billion

Answer:

meteorite 1- 2.6 billion

meteorite 2- 5.2 billion

meteorite 3- 3.9 billion

Explanation:

A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?

A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left

Answers

Answer:

Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30

F=ma.

30=30a

a=30/30

a=1m/s^2

In organ transplants, the body recognizes that the new organ is made of foreign cells. What kind of medicine would you give a patient to increase the chances of transplant success?

Answers

Answer:

immunosuppressant

Explanation:

After an organ transplant, you will need to take immunosuppressant (anti-rejection) drugs. These drugs help prevent your immune system from attacking ("rejecting") the donor organ. Typically, they must be taken for the lifetime of your transplanted organ.

All cells reproduce to make new cells. However, stem cells actually form many different types of cells. Adult stem cells can also repair tissues in the body.

1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.

Answers

Answer:

Explanation:

BY USING FOREST WISELY;

It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;

1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.

2) Those trees of the world make up of portion land species by more than forth or fifth portion.

There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as

hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth

Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.

COMMUNITY CONSERVATION;

It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.

These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.

There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as

Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.

The article 'By using Forest Wisely' can be summarised as:

People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem.

The trees produce oxygen and they made up at least a quarter of the world population.

The trees occupy the fourth or fifth portion of the land organisms.

In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die.

The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available.

Trees are required for manufacturing important materials.

The article 'Community Conservation' can be summarised as:

In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating.

The humans occupied the space to practice farming and make houses.

The population of the gorillas was disturbed and diminished.

The hunting of gorillas by poachers was also reduced.

The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife.

Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.

Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.

To know more about forest conservation, refer to the following link:

https://brainly.com/question/16505239

State the three parts of the cell theory.

Answers

Answer:

The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.

I need helppp :( science ~

Answers

I believe the answer is a prokaryote.

. Why is the carpel considered female and the stamen male?​

Answers

Answer:  A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.

Explanation:

When the total lunar eclipse occurs what are the relative positions of the sun earth and moon

Answers

Answer:

A lunar eclipse occurs when the Moon passes directly behind the Earth into its umbra (shadow). This can occur only when the sun, Earth and moon are aligned (in "syzygy") exactly, or very closely so, with the Earth in the middle.

Explanation:

Answer:

The earth is between the sun and the moon

Explanation:

The Moon is non luminous that is doesn't generate light by itself so it depends on light from the sun so when its path through which it taps light from the sun is totally covered it means the Earth is closer to the moon than the Sun so that the Earth gets all off its light leaving nothing for the Moon and in this case the Moon is thrown to total darkness.

The respiratory system is divided into two parts a) Air passage way b) The lungs
Please explain Air passage way.

Answers

Explanation:

The air passage way is connected to the through the main organ/thing is called the trachea. When you breathe in oxygen in order to get to the lungs air goes through the throat and your trachea. Same goes for when you breathe out carbon dioxide.

Answer:

From the nostril we get to the tubulates which leads to the nasopharynx from there it leads to the glotis and way down gets to the trachea from where it to the bronchi and finally branches to the bronchus.

burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%

Answers

Answer:

B i took the test

Explanation:

Answer: D

Explanation: Only 0.04% of the atmosphere is carbon dioxide.

Glaciers pushing rocks against rocks is an example of

Answers

Answer:

Erosion??

Explanation:

Answer:

Glacial Erosion

Explanation:

Describe natural selection

Answers

Answer:

Natural selection is the differential survival and reproduction of individuals due to differences in phenotype. It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.

Explanation:

best suited to the situation survive, and the ones that aren’t die

Which is the result of an object's motion?.

Answers

Answer:

Your answer would be if any of the object increases in mass. (A)

Explanation:

If we increase the mass of any object, the force of gravity would also increases.

hope it helps!

All living organisms are composed of what?​

Answers

All living organisms are composed of one or more cells.So, your answer would be Cell.

hope it helps!

Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball

Answers

Answer:

Kicking a soccer ball

Explanation:

Answer:

Kicking a soccer ball

Explanation:because moving blood and having a heartbeat arent in need of a skeletal system


The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow

Answers

Answer: a glacier; snow; ice

Explanation:

Just did it and it was right

Can somebody help with those 3 problems please

Answers

Answer:

first one is option A

second one option B

third is26 N

Explanation:

1.the law here is every action has an equal and opposite......

2. only unbalanced forces move objects from rest or of uniform motion

3.net force is the sum of forces ,if forces are in the same direction

hope this helps plz mark me brainliest

2) Option A.
Force is directly proportional to the mass. As the mass of the fuel deceases as the fuel is burnt, the force also decreases as force is directly proportional to mass, and as the force decreases, the acceleration decreases as acceleration is also directly proportional to the force, and the shuttle may eventually come to a stop due to the increasing deceleration. However, initially if the forces are kept balanced as the space shuttle and the gases exert an equal amount of force on each other in the directions opposite to each other, the object will keep on moving upwards in a constant velocity as the amount of force is also kept constant.


3) Option B.
The motion will definitely change when the forces acting on an object are unbalanced-it will start to move, accelerate or decelerate or change its direction in the direction of the net force. The object will not move at all or continue moving with the same velocity and in the same direction if the forces acting on it are balanced or zero.

4) When the forces are unbalanced and are acting on an object in the same direction, the net force will be found by finding the sum of those forces.
Net force=17+9=26 N.

I really, really hope this helps! And please mark it as brainliest.

What is a “shared derived character”?

Answers

Answer:

A shared character is one that two lineages have in common, and a derived character is one that evolved in the lineage leading up to a clade and that sets members of that clade apart from other individuals. 

Answer:

A shared character is one that two lineages have in common, and a derived character is one that evolved in the lineage leading up to a clade and that sets members of that clade apart from other individuals. Shared derived characters can be used to group organisms into clades. For example, amphibians, turtles, lizards, snakes, crocodiles, birds and mammals all have, or historically had, four limbs. If you look at a modern snake you might not see obvious limbs, but fossils show that ancient snakes did have limbs, and some modern snakes actually do retain rudimentary limbs. Four limbs is a shared derived character inherited from a common ancestor that helps set apart this particular clade of vertebrates.

I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order

Answers

Answer:

please put a picture of the work you have to do so i can help you

Explanation:

Other Questions
The landing of pollen on the stigma is followed by the growth of the pollentube towards the ovule. The pollen tube growth is guided by chemicals released from the pistil of the female flower. What is this type of growth inthe direction of chemicals called? positive chemotropism negative phototropism positive phototropism The human body contains many glands, including the pituitary, thymus, and thyroid. The table below shows the functions of two of these glands. Function 1. Associated with the immune system and is largest in size during teenage years 2. Produces hormones which are required for growth and various body functions Which of the following matches correctly the names of the glands with their functions? Group of answer choices PituitaryFunction 1; ThyroidFunction 2 ThyroidFunction 1; ThymusFunction 2 ThymusFunction 1; PituitaryFunction 2 PituitaryFunction 1; ThymusFunction 2 In an inelastic collision, which of the following statements is always true?[A] Kinetic energy is conserved in the collision.[B] Momentum is conserved in the collision.[C] After the collision, the objects always merge into one.[D] The collision takes more that 1 second to complete. Study the following quote. Then answer the question that follows."We ... enact, constitute, and frame such just and equal laws, ordinances, acts, constitutions, and offices, from time to time, as shall be thought most meet and convenient for the general good of the colony, unto which we promise all due submission and obedience."This quote from the Mayflower Compact helped American colonists understand the idea of A. petition B. constitutional monarchy C. tyranny D. social contract Young was elected senator from George true or false e is 5 more than d.fis 7 less than d.a) Write an expression for e in terms of d. When 1/2 of the number N is decrease by four, the result is -6. What is three times N added to seven? What enabled great Zimbabwe to become such a great city Please help me with those questions please please help 100 POINTSPLEASE PROVIDE STEPS.THANK YOU!!! YALL I NEED HELP MY DUMBSELF FORGETS TO DO THESE STUFF SMHCAN U ALSO EXPLAIN HOW U GOT THE ANSWER PLZ THXXI need to find the area A pipe branches symmetrically into two legs of length L, and the whole system rotates with angular speed around its axis of symmetry. Each branch is inclined at angle to the axis of rotation. Liquid enters the pipe steadily, with zero angular momentum, at volume flow rate Q. The pipe diameter, D, is much smaller than L. Obtain an expression for the external torque required to turn the pipe. What additional torque would be required to impart angular acceleration _ ? A square pyramid has a base with a total area of 144 m2 and the volume of 384m3, what is the slant height of the pyramid If I have a probability of 2/5, what is the percentage of probability.A. 52%B. 40%C. 2.5% D. 80% If I have a package deal if $80 what is the shipping price? PLEASE HELP Which sex cell is produced in males? When humans plant more trees, carbon can begin entering the ____a- hydrosphere b- geosphere c- biosphere 10 X 5/11= just multiplication get it right and get brainlyest60pts or whatever it narrows it down to I AM GIVING BRAINLIEST PLEASEE HELPPPP I NEED HELPPPPPP PLEAEEEEEE63.2 g of BaCl 2 are dissolved in enough water to make a 634 mL solution. What is the molarity? Which event convinced Cuba to seek help from the Soviet Union?