Answer:
All of the above.
Explanation:
Selective breeding is the process by which humans use animal breeding and plant breeding to selectively develop particular phenotypic traits by choosing which typically animal or plant males and females will sexually reproduce and have offspring together.
Please complete the following DNA strands
1. AGGTCCAAGCTCAAATTTCCCC
2. GAAACCCCTTAAACCTTAATTCC
3. GCGCGCGCAAATTTTTCCCATCT
Please complete the following strands using RNA:
1. AGGTCCCAAAGGCCCTTTCC
2. UAAAGGGCCCAGCCCACC
3. CUAAAAGGGGGUUUUAACC
Why are enzymes important for chemical
reactions?
Answer:
Enzymes greatly increase the reaction rate, or catalyze them.
Explanation:
Without them, many of us would not be alive, because the reactions wouldn't be fast enough!
Write a hypothesis showing the effect of nutrients in the soil on the growth rate of the tomato plant
Hypothesis:
As the tomato plant grows, nitrogen levels in the soil will decrease
A hypothesis showing the effect of nutrients in the soil on the growth rate of the tomato plant is As the tomato plant grows, nitrogen levels in the soil will decrease.
What is soil ?The soil is a mixture of different components which comprises minerals, organic matter, and living organisms, it is a loose sediment, Moreover, there are different types of soil like Clay Soil, Sandy soil, Loamy Soil, Silt Soil
soil it is One of the most crucial components of the biosphere, this particle is composed of 45% minerals, 50% spaces and 5% organic matter, the soil involve in many important functions such as Providing a growth medium for the plants, Acts a modifier of the earth’s atmosphere
The formation of soil involve in different process , it can be formed by weathering of rocks and the weathering of Solid rock occur in three way like Mechanical Weathering, Chemical Weathering, Biological Weathering
For more details regarding soil, visit
brainly.com/question/8937689
#SPJ2
Which of the following improves your range of motion and helps prevent
injuries?
A. A healthy body composition.
B. Strong flexibility,
C. Strong cardio-respiratory endurance.
D. A good sense of balance.
SUBMIT
Answer:
B. strong flexibility
Explanation:
Being flexible allows your body to move in a fuller range of motion and can help prevent injury because you aren't putting as much strain on yourself.
Select the conditions caused by fungi.
rust
yellow mosaic
barley yellow dwarf
blight
Stewart’s wilt
holcus spot
stalk rot
The major goal of the Social Gospel movement in the late 19th and early 20th century was to: Promote the spread of Protestantism in United States territories Promote the spread of Protestantism in United States territories Draw the attention of Protestant churches to the plight of the urban poor Draw the attention of Protestant churches to the plight of the urban poor Encourage support for Charles Darwin's theory of biological evolution Encourage support for Charles Darwin's theory of biological evolution Spread Nativist sentiments
Answer:
Draw the attention of Protestant churches to the plight of the urban poor.
Explanation:
The main aim and goal of the Social Gospel movement was to bring attention of Protestant churches to the difficult and dangerous solution of the urban poor. The main purpose of this movement is to combat injustice, suffering and poverty in the society. This movement started to solve the social problems such as social injustice, poverty, crime, economic inequality, alcoholism, Racial tensions slums, clean environment and child labor etc. This movement begun in the 20th century and has a great effects on he progressive-minded reformers.
Approximately time passes between B and F
Answer:
14 days
Explanation:
It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.
cohesion is a property water.Which of the following is NOT an example of cohesion
a.water is attracted to the sides of a glass cylinder
b.water strider can walk on water
c.water forming a drop on a penny
d.water molecules are attracted to each other
Answer:
A po kasi nga kapag ang tubig ay naisalin sa isang baso minsan ang tubig ay dumidikit sa baso tama diba kaya naman ang sagot ay A baka naman brainliest naman jan:)
Water is attracted to the sides of a glass cylinder is an example of cohesion.
What do you mean by cohesion?Cohesion means sticking together. If your group of friends heads to the lunchroom as a team and sits all together, you're demonstrating strong cohesion.
Cohesion allows for the development of surface tension, the capacity of a substance to withstand being ruptured when placed under tension or stress.
Cohesion refers to the attraction of molecules for other molecules of the same kind, and water molecules have strong cohesive forces thanks to their ability to form hydrogen bonds with one another.
Learn more about cohesion:
https://brainly.com/question/29598400
#SPJ2
Hanan ate a meal that consisted of rice, dal, fish and fried potatoes. Explain the process of digestion of the food with reference to the parts and enzymes involved in the digestive system.
Answer: A digestive system can be defined as a system which is made up of the alimentary canal and the associated glands and organs which produce some of the enzyme- rich secretions that bring about digestion. The process of digestion of food Hanan are, is discussed below.
Explanation:
The food taken by Hanan consist of carbohydrates (rice, potatoes ), protein( fish, dal) , fats and oil( fish, fried potatoes). The digestion of the food taken passess through a long tube ( alimentary canal) which stretches from the mouth through oesophagus to stomach, intestines and down to the anus.
In the MOUTH, the following occurs:
--> The food is cut and grinded into smaller pieces by the help of the teeth.
--> the enzyme ptyalin acts on the carbohydrate part of the food converting it to complex sugar.
--> the food is mixed with saliva, with the help of the tongue, is rolled into a bolus which is then swallowed.
At the STOMACH, food enters through the peristaltic movements of the oesophagus, The following occurs:
--> The muscular walls of the stomach contract and relax forcefully, thus churning the food.
--> Gastric juice( consists of pepsin, renin and dilute hydrochloric acid). Dilute hydrochloric acid activates pepsinogen to pepsin which digests proteins to polypeptides.
--> Food remains in the stomach for three to four hours. By this time, it is a thick, creamy fluid called chyme which them moves to the duodenum (small intestine).
At the SMALL INTESTINE, digestion occurs at the first part called the duodenum, and later part called the ILEUM.
--> Several substances are secreted into the duodenum from the pancreas( pancreatic juice) and liver( bile), the accessory organs of digestion.
--> pancreatic juice contains three important enzymes whose activities include:
• Amylopsin: Breaks down complex sugar to maltose
• Trypsin: breaks down protein into peptides
• Lipase: Breaks down fat into carboxylic acids and glycerol (end product of digestion of fat).
--> Bile from the liver, adds water to the chyme, emulsifies fat and neutralise the action of dilute hydrochloric.
At the ILEUM, intestinal juice is produced by special cells of the small intestine. Their actions include:
• maltase: this acts on maltose converting it to glucose( which is the end product of carbohydrate digestion).
• erepsin: This acts on peptides converting it to amino acids( which is the end product of protein digestion).
Absorption takes place at the small intestine.
When a blood clot breaks free and blocks a vessel leading to the brain a _______________________ can happen.
Answer:
a stroke can happen
Explanation:
A stroke can happen, right?
Can someone help me with his please?
callme 9473242403 0nly g
Answer:
you mean guys or gils hmm
Explanation:
What's does the term origin time mean in earth science
Answer:
Well depending on context it can mean different things, I could mean one of these three thing, choose the one you think is the most suitable,
(1) The birth, existence, or beginning; starting point. (2) The cause; that which causes something to arise. (3) That which acts as the source or that which from where something is derived.
T-lymphocytes are created in the bone marrow and then developed in the
spleen.
adenoids.
thymus.
tonsils.
Answer: I would say it is in thymus.
Answer:
It is thymus, I just did the question and got it right.
If the DNA sequence is GCTCAATTCGACCTA, the complementary RNA
sequence created during transcription is
Answer:
CGAGTTAAGCTGGAT
Explanation:
thymine pairs with adenine and guanine pairs with cytosine
T-A
G-C
anyone know the answer??????????????????????????????????
Answer:
The first one is the answer
Explanation:
Kingdom: Animal
Genus: Leucocephalus
Species: Haliaeetus
In pea plants, yellow pea color (Y) is dominant over green pea color (y).
What would the phenotype be if the genotype is Yy.
Answer:
So we know that yellow pea is dominant over green pea
then offspring might be 75% yellow pea and 25% green pea. Since yellow pea is dominant I feel like it will still be Y because its dominant
The diagram below represents the circulation of air above Earth's surface at a coastal location during the day and at night.
This local air movement is best described as an example of
1.
conduction between Earth's surface and the atmosphere above it
2.
condensation of water vapor during the day, and evaporation of water during the night
3.
convection resulting from temperature and pressure differences above land and water
4.
greater radiation from the warmer ocean during the day and from the warmer land at night
Submit Answer
Answer:
3. convection resulting from temperature and pressure differences above land and water
Explanation:
Due to the the difference between the ability of land and to water to absorb and radiate heat energy, the land gets heated up by the sun more quickly than water during the hot afternoons. As a result, the air above the land surface gets heated up more quickly than that above water. Warm air being less dense than cold air will rise above to atmosphere creating a low pressure area on land. On the other hand, air above water is not heated up as quickly, thus the dense cooler air over water will rush in and replace the warm air that has risen above the land surface.
At night, the land cools off more easily than water, hence the air above the land surface is cooler. On the other, water does not lose heat as quickly as the land, hence the air above the water surface is warmer than that over land. Warm air over the water surface will rise above, while colder air from land will replace it.
Is the thermos considered a conductor or insulator?
Answer:
no
Explanation:
HELP IT DUE NOW !!!!!!!!!!!!!!!
An area that is in the early stages of secondary succession will typically contain
rock lichens.
evergreen trees.
perennial shrubs.
annual grasses.
what is formed during photosynthesis
Answer:
Glucose and oxygen is produced
Explanation:
oxygen is usually released as a by-product and the glucose made is converted to starch and stored in leaves
plus ATP molecules are formed from excess light energy and is converted to a high energy chemical compound
High levels and long periods of stress can increase a person's risk for many diseases
True
False
Answer:
This is true many people can get many diseases from stress.
Answer:
True, go on this for your assessment I commented on ur other post too, https://quizlet.com/341036936/chapter-11-lesson-3-flash-cards/
Explanation:
Which one is the true answer
A
B
C
D
Need help PLEASEE
[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]
Ur answer is D.Thanks,
match the following
(i) Stem tuber (a) minerals
(ii) Conditioned Reflex (b) Blue green algae
(iii) Blood Circulation (c) potato
(iv) Pancreas (d) chlorosis
(v) Autotrophs (e) Pavlov's Experiment
(vi) Active transport (f) Insulin
(g) William Harvey
Answer:
Stem tuber ---- Potato
Conditioned reflex ---- Pavlov's experiment
Blood circulation ---- William harvey
Pancreas ---- Insulin
Autotrophs ------ Blue green algae
Active transport ---- Minerals
Note: Chlorosis has no matching item in the list. Explanation is given below.
Explanation:
Stem tubers are plants which store their food in their stems. Potatoes are stem tubers.
Conditioned reflex is a reflex is acquired gradually by training in association with specific repeated external stimuli. For example, the Russian psychologist Ivan Pavlov's performed experiments on conditioned reflex using a dog. He demonstrated that a dog will salivate on the sound of a bell even if there is no food given to it if the ringing of the bell preceded every feeding session of the dog.
William Harvey discovered the circulation of blood and the function of the heart .
The islets of Langerhans found in the Pancreas secretes the hormone, insulin.
Autotrophs are organisms which are able to manufacture their own food, Blue green algae are examples of autotrophs.
Active transport is transport which requires expenditure of energy and occurs against the concentration gradient of the substance being transported. Because the concentration of minerals in the soil are in very low concentration, active transport is used by the root hair cells carrier proteins to move mineral ions across the membrane into the cell against the concentration gradient. ATP hydrolysis provides the energy for this process.
Chlorosis is a disease which appears as the yellowing of leaves in plants and in human a green tinging of the skin which is caused by the deficiency of minerals especially iron and manganese.
How does factory farming impact workers, specifically undocumented people and people of color?
Answer:
Driven by rigid contracts set forth by their corporate partners, factory farms knowingly jeopardize workers' health in order to maximize profits. A large percentage of factory farm workers are black and brown peoples including migrant workers from Mexico and other parts of Latin America.
Explanation:
Heat energy is the transfer of _______ energy. A. chemical B. thermal C. electrical D. mechanical PLS HELP
What is an example of a learned behavioral adaptation?
O camouflage
O hunting
O hibernation
O migration
Answer:
Hunting
Explanation:
Camouflage is a hereditary physical aspect, whereas hibernation and migration are instinctual. Hunting is a learned behavior as it is not as ingrained as the other two and is not automatically done.
P.S. at first I read the answer choices to the tune of "O, christmas tree"
Which limiting factor is being displayed when a fox chases after a pika
There are 450 calories in 100 g of trail mix. If you burn 30 calories in 10 minutes of walking, how much trail mix should you eat to replenish the energy you spend walking for 2 hours?
Answer:
to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten
Explanation:
Firstly, let us calculate the number of calories burnt in 2 hours
in 10 minutes; 30 calories are burnt
∴ in 1 minute 30/10 calories are burnt = 3 calories are burnt
2 hours = 120 minute
∴ in 120 minutes 3 × 120 = 360 calories are burnt.
Next, let us calculate the amount of trail mix that contains 360 calories
100g of trail mix = 450 calories
450 calories = 100 g
1 calory = 100/450
∴ 360 calories = 360 × (100/450)
= 360 × 0.222 = 80g
∴ to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten