Which refers to the amount of heat required to change the temperature of 1 gram of a substance by 1°C and is related to the chemical composition of the substance?

Thermal energy
Specific heat
Activation heat
Boiling point

30 points

Answers

Answer 1
a. thermal energy
hope this helps
Answer 2
Yeah it’s thermal energy

Related Questions

This question is about magnets and net force (I think.) Please no absurd answers!

Answers

Answer:

D

Explanation:

Ok this is what I think I think it's D because when two mangnets have a force upon one thing at the same time I don't think it would move

What grade is this? This seems kinda weird

Which is a characteristic of an amorphous solid?


has a distinct melting point

becomes softer as temperature rises

particles arranged in a repeating pattern

made up of crystals

Answers

Answer:

4. Becomes softer as temperature rises

Explanation:

An amorphous solid is any noncrystalline solid in which the atoms and molecules are not organized in a definite lattice pattern. Such solids include glass, plastic, and gel. Solids and liquids are both forms of condensed matter; both are composed of atoms in close proximity to each other.

Based on the pattern of the P and S waves, what type of material is this planet made of?

(Tried to pick a subject but I could not find Science.)

Answers

Answer:

solid 6.

Explanation:

Observe the path taken by P and S waves in the model planet.

For this situation to demonstrate a balanced force, how much force must Omar apply? (In the picture, Sam is pushing a box to the right with a force of 10N, and Omar is pushing the box to the left with a force of _____ N)



Question 8 options:

10 N


20 N


100 N


0 N

Answers

The answers 10N as it equals it out
the answer is 10N since it is a balanced force

Which statements describe density? Check all that apply.
A. Density is a chemical property of an object.
B. The density of an object is constant.
C. Density is a derived unit of measure.
D. Density is the sum of the mass and volume of an object.
E. The density of an object determines whether it will sink or float.​

Answers

Answer:

D) Density is the sum of the mass and volume of an object

What are somethings about the Heliocentric model?

Answers

Answer:

Heliocentrism, a cosmological model in which the Sun is assumed to lie at or near a central point (e.g., of the solar system or of the universe) while the Earth and other bodies revolve around it.

Explanation:

This chart lists four examples of two objects that are in contact.

A 3-column table with 4 rows. The first column has entries Example 1, Example 2, Example 3, Example 4. The second column labeled Object 1 has entries fire, a metal at 80 degrees Celsius, the cool ocean, a tool with a lot of thermal energy. The third column labeled Object 2 has entries air, a metal at 12 degrees Celsius, the warm air, a material with little thermal energy.

Which statement accurately describes the flow of heat in each example?

Heat will flow from Object 1 to Object 2 in examples 2 and 4, and heat will flow from Object 2 to Object 1 in examples 1 and 3.
Heat will flow from Object 1 to Object 2 in examples 1 and 3, and heat will flow from Object 2 to Object 1 in examples 2 and 4.
Heat will flow from Object 1 to Object 2 in Example 3, and heat will flow from Object 2 to Object 1 in examples 1, 2, and 4.
Heat will flow from Object 1 to Object 2 in examples 1, 2, and 4, and heat will flow from Object 2 to Object 1 in Example 3.


30 points

Answers

4. Is the answer enjoy
Option 4 is answer
Mark me brainlist plzzz

Had to repost got deleted


Fill in the blank.

I gatta _____ ___ walk and _____ ___ mouth
- Megan thee stallion

Answers

Answer:

stank as$    reckless as$

Explanation:

What happens when warm air rises? (5 points) (will give brain)

a
Global temperature decreases.

b
The movement creates a difference in air pressure.

c
Cool air rises with it.

d
It moves towards the poles.

Answers

Answer:

b)

movement creates a difference in air pressure.

as warm air rises up it creates a vaccum so due to that the pressure in that region decreases.

Answer:

B. The movement creates a difference in air pressure.

Explanation:

GIVING AWAY 38 POINTS

Explain the three properties of sound.

Answers

Properties of sound include speed, loudness, and pitch. The speed of sound varies in different media. The loudness of sound depends on the intensity of sound waves. The pitch of sound depends on the frequency of sound waves.

Easy Plz Help
Physics

Answers

Answer:

is it conduction because in that case it would be

Explanation:

the process by which heat or electricity is directly transmitted through a substance when there is a difference of temperature or of electrical potential between adjoining regions, without movement of the material.

A magician pulls a tablecloth out from under dishes and glasses on a table without disturbing them. Make your claim and support it with evidence/reasoning. Write using complete sentences. 1st Law - Law of Inertia

2nd Law - Law of Force and Acceleration

3rd Law - Law of Action-Reaction

Answers

the magician is magic that’s how
1st Law - The force did not act on the dishes and glasses, so they stay at rest.

Does mass influence how quickly an object falls?

Answers

Both objects fall at the same speed. Mass does not affect the speed of falling objects, assuming there is only gravity acting on it.
both fall at the same time

Please check my answers.

Answers

Those answers are correct!!

ILL MARK BRAINLEIST
10 POINTS ILL GET YOU MORE FOR HELPFUL ANSWERS

Drag each label to the correct location on the image.

Jessica is visiting a park with her mother. Jessica sits on a swing. Her mother pulls the swing to a height of 3 meters above the ground and lets it go. The image shows Jessica at three positions on the swing. Jessica‘s mass is 44 kilograms and the maximum velocity of the swing is 5 meters/second. What’s the energy she has at each position shown? Ignore friction and air resistance.

Answers

Answer:

we can't but the 1rst one on right 2nd one on left 3rd one on middle

Explanation:

Hope that helps :D brainliest PLEASE!

This question is about the Earth's atmosphere and light/sound waves.

Answers

it’s c , most likely

A student made the table shown to list some contact and non-contact forces.


Examples of Forces
Contact Forces Non-Contact Forces
The force exerted by a stretched spring The force applied by Earth and sun on each other
The electrical force exerted by a positive charge on a negative charge Magnetic attraction between two magnets


Which statement best explains why the table is incorrect?
Spring force is a force acting at a distance.
Electrical force is not a contact force.
Gravitational force can act between planets and sun only when they are in contact.
Magnetic attraction is a contact force

Answers

Speed force acting at a distance

Other Questions
A mass of 630g is hung on a spring. Using Force = mass x gravity, what is the force of the mass, acting on the spring? What can you infer about the schools educational and social goals, based on Doves experiences? Someone help me match the last two to their definition Hypotonic and Isotonic help would be appreciated ** if you could explain thatd be cool but if not thats ok 0.47 100with process Mircale are u online right now I need to talk to you pls Attempt 1Question You see Fred, a co-worker, not following safety procedures. What would be the bestthing to do?A) nothing, as his safety is his own responsibilityB) pretend you didn't see him, but consider telling the bossC) talk to him about putting his safety at riskD) follow his example -- maybe the safety procedures are not necessary What does x stand for in math Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3 Kaden, Keith, and Kipp compete in a series of daily 3-way races. For each race, the probability that Kaden wins is 1/6, the probability that Keith wins is 1/2, and the probability that Kipp wins is 1/3. On a day that Kaden doesn't win, what is the probability that Keith beats Kipp? a file that serves as a starting point for a new document Which resource is renewable?coal oilsteelwind What is civilization? How did the Native American tribes fit into the concept of civilization? Were some tribe more civilized then others? If so, how ?(YOUR OWN WORDS 300 words pls !!! 10 POINTS) Rebeca is writing a letter to a cousin telling what her new neighbors do. Choose the statements below that best match herdescriptionsEl vecino que vive en el apartamento grande cuida los dientes de los clientes.a. l es periodista.c. l es dentista.b. l es polica. A dental hygienist is a health-care professional who works alongside a dentist to meet the oral health care needs of patients. Asked by one of her clients who needs to get a cavity filled what the average number of cavities a person gets filled by the time they are 50 years old, the hygienist responds that she will gather and determine not just the average, but also the median and the mode - because she would like to know this information herself. A bit of research turns up the following data table taken from a research project of a graduate student. The graduate student surveyed 20 people aged 50 from around Idaho.Patient ID# Cavities Filled1 12 83 74 95 116 127 78 59 210 011 812 913 714 615 816 917 818 919 820 8a. What is the mean (average) number of cavities a person gets filled by age 50?b. What is the median number of cavities a person gets filled by age 50?c. What is the most often an occurring number of cavities filled in this data set?