Answer:
The liver, pancreas, and gallbladder are the solid organs of the digestive system. The hollow organs that make up the GI tract are the mouth, esophagus, stomach, small intestine, large intestine, and anus. This is a major contributing factor for our bodies being able to keep homeostasis.
two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad
Answer:
A. wheter the producers are located on land or in the water.
What are the non-living components of an ecosystem?
A single species can feed at only one tropic level
True
False
Answer: True sorry if I’m wrong.
Explanation:
Answer:
True
Explanation:
which process produce two genetically distinct haploid cells
Answer: mitosis
Explanation:
Each Taxonomy (category) gets less and less specific as they go further down the list.
A. True
B. False
Answer:
B. False
Explanation:
The levels of classification, from broadest to most specific, include: kingdom, phylum, class, order, family, genus, and species.
Answer:
B. False
Explanation:
Taxonomy is the study of the general principles of scientific classification.
What does "synthesis" mean?
A. to read DNA
B. to tear apart
C. to make something
Answer:
I believe it is C to make something
pushing a chair requires less energy than pushing than pushing a desk because
A. The surface area of the desk is larger.
B. The desk has less mass then then the chair
C. The chair has less mass then the desk
D. The chair is smaller
Answer:
c
the chair has less mass then the desk
write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond
(See the attached picture)
Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.
Answer:The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.
The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.
Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.
Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.
I hope it helps!!The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.
How is the zygote formed and developed?The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.
The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.
Hence, all of these events occurred from the zygote to the child's maturity.
Learn more about the zygote here.
https://brainly.com/question/465851
#SPJ2
Which of the following is a subsystem of an organism?
a.cell
b.organ system
c.tissue
d.all of the above
Answer:
d
Explanation:
Identify what holds DNA, the hereditary information of a cell?
(Its not the nucleus)
PLEASE HELP!
Answer:
chromatin network or chromosomes
i need help with this question
what is a halflife in science?
One-half of the atomic nuclei of a radioactive sample to decay
Farmer toon soon wanted to start breeding his plants so that they are resistant to disease while producing more fruit per plant.Which plants should the farmers cross to get the desired (wanted) combination of traits
Answer:
cultivated plant variety with its wild type variety.
Explanation:
The farmer cross the cultivated plant variety to its wild type which has the characteristics of resistance against diseases. Due to crossing, the offspring produce having resistance against that disease as well as producing high yield. This type of crossing is known as artificial selection in which humans cross two organisms to get the desired characteristics in their offspring so to get a plant with resistance against disease we cross cultivated plant variety to its wild type.
Write mechanism of absorption
Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)
Answer: I don't know
Explanation: i am brainless
Summary of human nutrition
Answer:
Human nutrition is the process of which substances are Transformed into tissues and energy which are used up to mental and physical activities!
is eczema recessive or dominant? explain why or how.
Answer:
When caused by CARD11 gene mutations, atopic dermatitis has an autosomal dominant inheritance pattern , which means one copy of the altered CARD11 gene in each cell is sufficient to cause the disorder.
Explanation:
pls mark brainlest
The skull and vertebrae are part of the _________ in vertebrates. circulatory system endoskeleton nervous system exoskeleton Science
Answer:
Endoskeleton
Explanation:
Hope this helps!
Answer:
nerveos systum i think is tha anser
what are cells surrounded and protected by?
Answer:
cells are surrounded by a structure called the cell membrane — which, much like the walls of a house, serves as a clear boundary between the cell's internal and external environments. The cell membrane is sometimes also referred to as the plasma membrane.
Answer:
The plasma membrane, or cell membrane
Explanation:
If y'all know science can y'all do dis, it's a multiple-choice question
' What is the net force required to give a box of mass 5 kg an acceleration of 4 m/s2 ?'
The answer to the question is
The number 20.
Hope this helps you. Sorry if i am wrong.
Which process produces genetically identical cells?
A. Meiosis
B. Mitosis
Answer:
mitosis produce genetically identical cells
Answer:
B mitosis i think .......
Which of the following best represents the purpose of fertilizers?
Answer:
Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.
Explain how different types of cells help organisms live and grow?
Different types of cells have different jobs that are necessary to keep organisms alive.
Different types of cells are only found in specific types of organisms.
Cells are necessary in order for all organisms to grow big and hunt for their food source.
Cells provide support for all organisms to be able to move.
Answer:
Different types of cells have different jobs that are necessary to keep organisms alive. And cells also give the living animal more support. They also hold the genetic information of that organism in their nucules. This is with most cells but bacteria cells do not contain nucules.
Starch is a polysaccharide used as a component of cell walls in plants.
True
False
Answer:
false
Explanation:
is type of carbohydrates
False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.
What are structural component of cell wall?Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.
Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.
Learn more about cell wall, here:
https://brainly.com/question/965751
#SPJ2
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
When and where would you expect to find the highest rate of primary productivity
Answer: Net primary productivity is the amount of gross primary productivity remaining after respiration, which is about 40 and 85 percent. Sloughs and marshes, as well as tropical rain forests, possess the highest rates of net primary productivity; deserts have the lowest.
Explanation:
I explained on the top-
The highest rate of primary productivity in terrestrial environments takes place in swamps and marshes and in tropical rainforests, and in aquatic environments it takes place in algal beds, estuaries, and reefs.
• In ecology, primary productivity refers to the rate at which conversion of energy to organic substances takes place by the photosynthetic producers that attain energy and nutrients from the sunlight, and chemosynthetic producers that attain chemical energy via oxidation.
• The majority of the energy assimilated by plants via the process of photosynthesis is not stored as organic substance, however, is utilized at the time of cellular respiration.
• In the process, the organic components like proteins, carbs, and fats are dissociated to provide energy in the form of ATP for the metabolic needs of the cells.
• The energy not utilized is stored in the tissues of the plants for future use and is known as the net primary productivity.
• The highest net primary productivity in terrestrial environments takes place in marshes and swamps and in tropical rainforests, and in aquatic environments it takes place algal beds, estuaries, and reefs.
These environments are mainly critical for the sustenance of global biological productivity.
To know more about:
https://brainly.com/question/14017102
The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent carbon sinks?
A. marine photosynthesis and respiration
B. volcanoes and soil carbon
C. oceans and fossil carbon
D. factories and photosynthesis
Answer:
D) Factories and Photosynthesis
99% of the GMOs on the planet are ____
or ____
Answer:
The answer would be pesticide producers and herbicide resisters.
Explanation:
Hope this helped!
Because it is ______ , fermentation _______ oxygen.
Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require
Answer:
anaerobic/does not require
Explanation:
anaerobic occurs in the absence of oxygenIf earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.
B.
Nitrogen is unusable in its liquid form.
C.
There are more plants than gaseous nitrogen.
D.
Nitrogen is unusable in its gaseous form.
The ___ of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The ___ of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, ____ either break or form.
Thus, water absorbs or releases a great deal of ____, helping to moderate temperatures.
Water is a versatile ____.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved ______.
Answer:
The polarity of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The cohesion of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, hydrogen bonds either break or form.
Thus, water absorbs or releases a great deal of heat, helping to moderate temperatures.
Water is a versatile solvent.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved solutes.
Explanation:
The sentences presented in the question above had their various spaces complemented by the words that best fit the sentence and that were capable of forming true invormations on water.
Water is a very versatile solvent as it is capable of dissolving and mixing with various substances both liquid and solid. Furthermore, water has a great capacity to absorb or release heat, which is very useful for the entire planet, as this allows water to be very efficient in regulating temperature.
Water is formed by H2O molecules, which hold these molecules together are the hydrogen bridges formed between them. Hydrogen bridges are broken through heat, which allows the water to evaporate, but at low temperatures these bridges are strengthened and new bridges can be created, which allows the water to become solid.
The properties of water are extremely important for life on the planet and for most biological processes we know about. Among these properties we can mention polarity and cohesion as one of the most important. Polarity allows water to be a polar substance, while cohesion allows water to create an attractive relationship between molecules.
