Write the product in its simplest form 5c7 x 5c8

Answers

Answer 1

Answer:

25c²56

Step-by-step explanation:


Related Questions

in the month of July 3/8 of the shoes that were sold at the Houston of style footwear were sandals and 1/16 were clogs. what fraction of the shoes where either sandals or clogs?​

Answers

Answer:

7/16 of the shoes were either sandals or clogs.

Step-by-step explanation:

Find a CD, which is 16.

Because we multiplied the denominator, we multiply the numerator as well.

3/8 becomes 6/16.

Now, because both of the denominators are the same, we are free to add both of the fractions together.

6/16 + 1/16 = 7/16.

Because this fraction isn't reducible, the answer will be 7/16.

Two families are saving money for a vacation. The Juarez family has saved $1000 and will save $50 more each week. The Kim family has saved $500 and will save $75 more each week. Write a system of equations to represent how much money each family will save.

Answers

Answer:

There are many ways you could put this let me demonstrate.

Step-by-step explanation:

If they were to do this for a year (52 weeks) that would be 50x52=2600+1000=3600. Then 75x52=$3900+500=$4400. but if you were to cut that time in half to 6 months it would go something like this. 50x26=1300+1000=2300. Then 75x26=1950+500=2450. It all has to do with the time. I hope this helped.

What probability statement would you add to ​P(blue) = 1 10 to make a complete probability model for the event choosing a foam ball at random from the​ box?

Answers

Answer:

The chances of landing on blue are 1 in 4, or one fourth. The chances of landing on red are 1 in 4, or one fourth. This problem asked us to find some probabilities involving a spinner.

What is the solution set of x2 – 10 = 30x?

{–220, 250}
{–250, 220}
{15 – StartRoot 235 EndRoot, 15 + StartRoot 235 EndRoot}
{–15 – StartRoot 235 EndRoot, –15 + StartRoot 235 EndRoot}

Answers

9514 1404 393

Answer:

  (c)  {15 -√235, 15 +√235}

Step-by-step explanation:

For solutions p and q, the trinomial is ...

  (x -p)(x -q) = x² -(p+q)x +pq

That is, the constant term (-10) must be the product of the roots, and the x-coefficient (-30) must be the opposite of their sum.

The sums of roots in the answer choices are ...

  a) 30

  b) -30

  c) 30

  d) -30

We know the sum of roots is 30, so we can eliminate choices 'b' and 'd'.

The product of the roots must be -10, eliminating choice 'a'. Thus, the only viable choice is C.

_____

The product of the roots of C is ...

  (15 -√235)(15 +√235) = 15² -235 = -10 . . . . as required

Answer:

C

Step-by-step explanation:

Which graph represents exponential decay?

On a coordinate plane, a straight line has a negative slope.

On a coordinate plane, a curve approaches y = 0 in quadrant 2 and curves up in quadrant 1.

On a coordinate plane, a straight line has a positive slope.

On a coordinate plane, a curve approaches y = 0 in quadrant 1 and curves up in quadrant 2.

Answers

The graph which shows the function is exponential decay is on a coordinate plane, a curve approaches y = 0 in quadrant 1 and curves up in quadrant 2 thus, option (D) is correct.

What is an exponential function?

In mathematics, an exponential function is a relationship of the type y = ax, where x is an independent variable that spans the entire real number line and is expressed as the exponent of a positive number.

As per the given,

The exponential function is a function that changes rapidly, for example, y = 6^x here as x approaches higher the y approaches rapidly higher.

Exponential decay is the exponential function that rapidly decreases as x increases for example y = 6^(-x).

The graph of the exponential decay has been graphed below.

Hence "The graph which shows the function is exponential decay is on a coordinate plane, a curve approaches y = 0 in quadrant 1 and curves up in quadrant 2".

For more about exponential function,

https://brainly.com/question/15352175

#SPJ6

Answer:

D

Step-by-step explanation:

edge

hope this helps :)

Please help question in the picture

Answers

Answer:

64 m²

Step-by-step explanation:

Area of the trapezoid = ½(a + b)h

Where,

a = 6 m

b = 10 m

h = 8 m

Plug in the values

Area = ½(6 + 10)*8

Area = ½(16)*8

Area = 8*8

Area = 64 m²

PLEASE HELP 100 points I’m on a time(there’s a picture) With respect to air safety, in which year between 1966 and 1976 did the lowest number of air fatalities occur, and how
many passengers were killed in that year?
Year:1976,1974,1975
Passengers killed: 552,441,386

Answers

Looking at the column for number of passengers killed.

The lowest year was 1975 with 441 killed.

Answer:

1975

441

Step-by-step explanation:

(-10) + 3 = 10 - 3 is true or false??? ​

Answers

(-10) + 3 = -(10 - 3) = -7

10 - 3 = 7

-7 ≠ 7

FALSE

What is the approximate area of this figure?

A. 25 cm
B. 31 cm
C. 38 cm
D. 42 cm

Answers

Answer:

I would say about B. 31 cm

Step-by-step explanation:

if you cut the shape into a triangle and a parallelogram, then you can easily guess that the other side of the square is about 4, and 4 x 4 is 16.. then you will multiply 8 by 4 and get 32 and then divide that by 2 and get 16 again, when you add both 16's together, you get 32, but 31 is closest

Find the value of the trig function indicated

Answers

Answer:

A. (2√13)/13

Step-by-step explanation:

Recall, SOHCAHTOA.

Thus,

Cos θ = Adjacent/Hypotenuse

Adjacent = 16

Hypotenuse = 8√13

Therefore,

Cos θ = 16/(8√13)

Rationalize

Cos θ = (16*√13)/(8√13*√13)

Cos θ = (16√13)/(8*13) = (2√13)/13

5. In a right triangle, the sum of the lengths of the two legs is 100 meters. What are the lengths of the three sides
of this right triangle if the triangle's area is maxed out?

Answers

Answer:

6m by 8m by 10m

Step-by-step explanation:

6²+8²= 100

36+64=100

100=100

me ayudan por favor?
solo son 10 preguntas abc

Answers

Answer:

hi

Step-by-step explanation:

Unit 10 circles homework 2 back side

Answers

There’s no question?

Marcelo can select from 2 types of oranges and 3 types of peaches. If he randomly selects 1 orange and 1 peach, how many possible choices does he have? ___________ possible choices

Answers

Answer:

6 choices

Step-by-step explanation:

o que significa 1E+76 ?????

Answers

Answer:

e means error at least when the number is higher than the computor can calculate or it is just a variable

Step-by-step explanation:

I’ll mark as BRANLIEST!!

35 POINTS!!

- Determine whether each table or rule represents a linear or exponential function. Explain why or why not.

Answers

1 is exponential because the numbers, when multiplied together, do not make the same numbers

2 is exponential because of an exponent being the modified variable

3 is linear because it is just multiplication which is a simple pattern

Answer:

Definitions of gravitational force. (physics) the force of attraction between all masses in the universe; especially the attraction of the earth's mass for bodies near its surface. synonyms: gravitation, gravitational attraction, gravity.

My sister got stuck on these can you tell me the answers?

Answers

don’t click the link above it’s a scam. also i think you measure the eraser using a ruler and that’s the answer lol

Find the equation of the line specified.
The slope is -7, and it passes through ( 5, -3).
a.
y = -7x - 3
c.
y = -14x + 32
b.
y = -7x + 32
d.
y = -7x - 38

Answers

Answer and working out attached below. Hope it helps

Estelle swims for the Shorewood Sharks swim team, Last season, she kept track of how far
she swam at each practice.
Distance swam (m)
+
1,000
1,400
1,800
2,200
2,600
3,000
What was the shortest distance Estelle swam at practice?
meters

Answers

Answer:1,400

Step-by-step explanation:

The shortest distance Estelle swam at practice is 200 meters if the Estelle swims for the Shorewood Sharks swim team

What is the box and whisker plot?

A box and whisker plot is a method of abstracting a set of data that is approximated using an interval scale. It's also known as a box plot. These are primarily used to interpret data.

We have box plot data:

1,000    1,400    1,800    2,200    2,600    3,000

From the box plot:

The shortest distance Estelle swam at practice is given by:

= 1800—(1400+1800)/2

= 1800 – 1600

= 200 meter

Thus, the shortest distance Estelle swam at practice is 200 meters if the Estelle swims for the Shorewood Sharks swim team

Learn more about the box and whisker plot here:

brainly.com/question/3209282

#SPJ2

ANSWER !!
ILL GIVE 40 POINTS !!
DONT SKIP :((
PLUS BRAINLIEST !

Answers

Answer:

[tex] \sqrt{18 } is \: a \: \: answer \: pls \: follow \: me[/tex]

Answer:

Step-by-step explanation:

-3i Square root of 2

Please help with this

Answers

9514 1404 393

Answer:

  15.4 square feet

Step-by-step explanation:

The area of the painting will be the area of the sketch multiplied by the square of the ratio of linear dimensions.

  painting area = (0.24 square feet)(8^2) = 15.36 square feet

The area of the painting is about 15.4 square feet.

What is the missing length?

Answers

3
This is because the area of a rhombus is A=sh
since the height is 4 mm, and the area is 12mm^2 the length is 3
I think the answer is 3mm

You have collected weekly earnings and age data from a sub-sample of 1,744 individualsusing the Current Population Survey in a given year. Given the overall mean of $434.49and a standard deviation of $294.67, construct a 99% confidence interval for averageearnings in the entire population. State the meaning of this interval in words, ratherthan just in numbers. If you constructed a 90% confidence interval instead, would itbe smaller or larger? What is the intuition?

Answers

Answer:

The 99% confidence interval for average weekly earnings in the entire population is between $416.42 and $452.66. This means that we are 99% sure that the true population mean weekly earnings is between these two values.

Due to the smaller margin of error, the confidence interval would be smaller, that is, less likely to contain the true population mean.

Step-by-step explanation:

We have that to find our [tex]\alpha[/tex] level, that is the subtraction of 1 by the confidence interval divided by 2. So:

[tex]\alpha = \frac{1 - 0.99}{2} = 0.005[/tex]

Now, we have to find z in the Ztable as such z has a pvalue of [tex]1 - \alpha[/tex].

That is z with a pvalue of [tex]1 - 0.005 = 0.995[/tex], so Z = 2.575.

Now, find the margin of error M as such

[tex]M = z\frac{\sigma}{\sqrt{n}}[/tex]

In which [tex]\sigma[/tex] is the standard deviation of the population and n is the size of the sample.

[tex]M = 2.575\frac{294.67}{\sqrt{1744}} = 18.17[/tex]

The lower end of the interval is the sample mean subtracted by M. So it is 434.49 - 18.17 = $416.42

The upper end of the interval is the sample mean added to M. So it is 434.49 + 18.17 = $452.66

The 99% confidence interval for average weekly earnings in the entire population is between $416.42 and $452.66. This means that we are 99% sure that the true population mean weekly earnings is between these two values.

If you constructed a 90% confidence interval instead, would it be smaller or larger? What is the intuition?

For a 90% confidence interval, we would have z = 1.645.

Looking at the margin of error formula, M and z are direct proportional, that is, as z decreases so does M. Due to the smaller margin of error, the confidence interval would be smaller, that is, less likely to contain the true population mean.

In AJKL, j = 55 inches, k = 51 inches and L=38°. Find the area of AJKL, to the
nearest square inch.

Answers

Answer:

863

Step-by-step explanation:

From reference sheet.

Plug in values.

Area≈863.465≈863

Evaluate and round.

Select all statements that are true.
An acute triangle can be equilateral
An obtuse triangle can have more than one obtuse angle.
An equilateral triangle is always equiangular.
A right triangle can be scalene.
An acute triangle can be sosceles
A scalene triangle can be equilateral


Answers

The true statements are as follows

An acute triangle can be equilateral .An equilateral triangle is always equiangular. A right triangle can be scalene. An acute triangle can be isosceles.

The following statements considered to be false:

An obtuse triangle can have more than one obtuse angle.A scalene triangle can be equilateral.

Therefore, the above statements are considered true.

Learn more: brainly.com/question/17429689

Please help! What is the volume of the cone?

Answer and explanation please! <3

Answers

Answer:  V≈804.25

Step-by-step explanation:

V=πr2h

3=π·82·12

3≈804.24772

An equilateral triangle has a side length of 10 units. What is it’s area?

Answers

Answer:

[tex]25\sqrt{3}=43.3\ \mathrm{units}[/tex]

Step-by-step explanation:

Area of a triangle = [tex]\frac{1}{2}ab\textrm{sin}(\theta)[/tex] where [tex]a[/tex] and [tex]b[/tex] are the sides of the triangle and [tex]\theta[/tex] is the angle between those two sides.

The side length are 10, and since its an equilateral triangle, the angle is 60 degrees. Thus, the area becomes [tex]\frac{1}{2}(10)(10)\textrm{sin}(60)=25\sqrt{3}=43.3\ \mathrm{units}[/tex]

Find the highest common factor(HCF) of 18 and 24

Answers

18 - 2,3,6,8
24 - 2,4,6,8,12

HCF = 8

Solve each division problem, and classify it based on its quotient.

Answers

Answer:

show the image so i can answer

plz put the image  so i can see cus there are two types

HELP QUICK & NOW PLS
Trapezoid ABCD is inscribed in circle O. Diagonals BD and AC meet at point E and AD is
parallel to BC, as shown.
Select the angles and value that
make a true statement about
trapezoid ABCD.

(fill in equation to the right pls)

Answers

Answer:

I think this would be,

ADE = 180- BCE

I am not sure if this is the right answer, and i am sorry if the answer is wrong, i am just learning about this topic.

Answer:

m<ADC= 180-m<ABC or m<ABC=180-m<ADC

Step-by-step explanation:

Firstly, we need to establish that trapezoid ABCD is an isosceles trapezoid. By doing so, we know that angles opposite one another in an isoseles trapezoid are supplementary. As a result, m<ACD+m<ABC= 180. We can now solve for angle ACD or ABC.

Other Questions
Caleb has 3 packs of colored pencils. Each pack has x pencils in it. After Ryan gives him 6 morecolored pencils, he has a total of 27 pencils. plz help. need it done in 2 mins used to have a square garage with 296 ft of floor space. recently built an addition to it. The garage is still a square, but now it has 50% more floor space. What was the length of one side of the garage originally? What is the length of one side of the garage now? What was the percent increase in the length of one side? Please Answer! I will give brainiest. The Picture is down below :)Thank You! Larry has a cylinder shaped pictures that is 13 inches long and radius of 4 inches. Sandra has a cylinder shaped pitcher that is 8 inches long and radius of 6 inches. The volume of Larrys picture is approximately __. The volume of Sandras pitcher is approximately __? Delta math question - EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . A human resources manager selected a random sample of 200 workers who donate to charity. The following table shows the distribution of the 200 workers. Count Type of worker Management Other white collar 96 50 S Blue collar 54 The manager conducts a goodness-of-fit test to determine whether the proportions of workers of these types are identical to the population proportions of workers donating to charity, which are 50 percent for management, 30 percent for other white-collar workers, and 20 percent for blue-collar workers. Which of the following statements must be true about the sample?A. The expected number of blue-collar workers donating to charity is less than 30. B. The expected number of management workers donating to charity is 100. C. The expected numbers of other white collar and blue-collar workers donating to charity are the same. D. The expected number of other white-collar workers donating to charity is 50 E. The combined expected numbers of other white collar and blue-collar workers donating to charity is greater than the expected number of management workers donating to charity.