You have 1/8 gallon of melted crayon wax. You pour the wax equally into 8 different molds to make new crayons. What fraction of a cup of melted wax is in each mold? Think: 1 gallon is 16 cups.

PLS HELP

Answers

Answer 1

Answer:

2 cups

Step-by-step explanation:

16/8=2 so it is 2 cups


Related Questions

Help this is clever 8.4 I need this by 7

Answers

Answer:

Just do 8.4 times 7

Step-by-step explanation:

8.4 times 7 = 58.8

15% of $9.00 is $

I need help!!

Answers

Answer:

$ 1.35

Step-by-step explanation:

9 times 0.15 is 1.35

Answer this question to get marked as barinliest!!!!

Answers

3.14 × 16 = 50.24

C is ur answer

now gimme brainliest

Answer:

B or the second one i did  my math

Step-by-step explanation:

On Saturday, a local hamburger shop sold a combined total of 261 hamburgers and cheeseburgers. The number of cheeseburgers sold was two times the number of hamburgers sold. How many hamburgers were sold on Saturday?

Answers

Answer:

134 hamburgers

Step-by-step explanation:

Let H = # of hamburgers 

# of cheeseburgers = 2H

H + 2H = 402

3H = 402

H = 402/3

H = 134

There are 30 students in Mrs. Rodriguez’s class. 20% got an A on the test. How many students got an A?

Answers

Answer

6.

Steps

30/100×30

=6

Answer:

6

Step-by-step explanation:

There are 30 students

So,

20÷100×30=6

Find the volume of the cylinder. Find the volume of a cylinder with the same radius and double the height. Radius = 8, Height = 3.

Answers

Answer:

V = 603.19 unit^3

or

V = 192π unit^3

Step-by-step explanation:

V = πr^2 *h

V = π(8)^2 *3

V = 603.19 unit^3

or

V = 192π unit^3

Answer:

603.186^3

Step-by-step explanation:

v =  πR2 · h

π8^2 x 3

= 603.186^3

PLEASE PLEASE PLEASE PLEASE PLEASE PLEASE PLEASE HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP

Answers

The value of ∠FGJ = x⁰ is 45⁰.

What is Linear pair angle?

Linear pair of angles are formed when two lines intersect each other at a single point. The angles are said to be linear if they are adjacent to each other after the intersection of the two lines. The sum of angles of a linear pair is always equal to 180°.

Here, we know that sum of angles on linear pair is 180⁰.

        ∠FGJ = x⁰ and ∠JGH = 135⁰

∠FGJ + ∠JGH = 180⁰

    x⁰ + 135⁰ = 180⁰

    x⁰ = 180⁰ - 135⁰

    x⁰ = 45⁰

Thus, the value of ∠FGJ = x⁰ is 45⁰.

Learn more about Linear pair of Angle from:

https://brainly.com/question/26555759

#SPJ1

True or false is the graph of y = 2/3 x + 4

Answers

Answer:

False. 2/3 is positive so therefore, it would be increasing, not decreasing.

Step-by-step explanation:

what is the 3.5mi circumstances i also need help with this if you guys can help me

Answers

Udhehrbr shrugged dhehr when

Find the value of the variables in the simplest form

Answers

Answer:

y = 2

Step-by-step explanation:

Using Pythagoras' identity in the right triangle

y² = ([tex]\sqrt{2}[/tex] )² + ([tex]\sqrt{2}[/tex] )² = 2 + 2 = 4 ( take the square root of both sides )

y = [tex]\sqrt{4}[/tex] = 2

Sidney has $100 in a savings account. The interest rate is 10% per year and is not
compounded. How much interest will she earn in 3 years?

Answers

Answer:

130 dollars

Step-by-step explanation:

This time I don't think I done messed it up

Have a good day!

The copy machine runs for 20 seconds and then jams. About how many copies were made before the jam occurred? Round your answer to the nearest tenth

Answers

Answer:

10.7

Step-by-step explanation:

Raffia went shopping for new furniture he bought a couch for $750 and a mattress for 950 dollars. When he came home he had $350 in his purse. How much money did he have when he left home. Please answer step by step will mark brainliest and thanks !!!!!!!!!!!

Answers

Answer:

$2050

Step-by-step explanation:

750+950+350

You have to add how much he spent and how much he had left over. He spent $750+$950=$1700. And he had $350 left so you add the $1700 he spent plus the $350 he had left over meaning he had $2050 to begin with.

Which of the following are among the five basic postulates of Euclidean geometry? Check all that apply.

A. All circles have 360 degrees
B. A straight line segment can be drawn between any two points.
C. A straightedge and compass can be used to create a triangle.
D. Any straight line segment can be extended indefinitely.

Answers

Answer:

B and D.

Step-by-step explanation:

A p e x

The following are among the five basic postulates of Euclidean geometry

A straight line segment can be drawn between any two points.Any straight line segment can be extended indefinitely.

The five basic postulates of Euclidean geometry

The five (5) basic postulates are:

Any segment of a straight line connecting any two points can be drawn.You can draw and stretch any straight line to any finite length.Given a centre and radius, circles are drawn.Congruent angles are always right angles.There is a line that is parallel to the given line if a given point is not on the supplied line.

Learn more about Euclidean Geometry here:

brainly.com/question/17304015

#SPJ7

Make up any linear equation with two variables the solution to which will be these pairs of numbers. x=2, y=4.5 PLS HELP

Answers

Answer:

[tex]y = 0.25x + 4[/tex]

[tex](x,y) = (2,4.5)[/tex]

Step-by-step explanation:

Given

[tex]x = 2[/tex]

[tex]y = 4.5[/tex]

Required

Make up a linear function

A linear function is represented as:

[tex]y = mx + b[/tex]

Assume [tex]b = 4[/tex]

The equation becomes

[tex]y = mx + 4[/tex]

Substitute [tex]x = 2[/tex] and [tex]y = 4.5[/tex] to solve for m

[tex]4.5 = m*2 + 4[/tex]

[tex]4.5 = 2m + 4\\[/tex]

Solve for m

[tex]2m = 4.5 - 4[/tex]

[tex]2m = 0.5[/tex]

[tex]m = 0.5/2[/tex]

[tex]m = 0.25[/tex]

So, we have:

[tex]m = 0.25[/tex], [tex]b = 4[/tex], [tex]x = 2[/tex] and [tex]y = 4.5[/tex]

[tex]y = mx + b[/tex] becomes

[tex]y = 0.25x + 4[/tex]

[tex](x,y) = (2,4.5)[/tex]

The slope of a line is 2. The y-intercept of the line is –6. Which statements accurately describe how to graph the function?
Locate the ordered pair (0, –6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points.
Locate the ordered pair (0, –6). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points.
Locate the ordered pair (–6, 0). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points.
Locate the ordered pair (–6, 0). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points.

Answers

Answer:

Locate the ordered pair (0, –6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points.

Step-by-step explanation:

(0, -6) is the y-intercept, as x = 0.  Moving up 2, and right 1 represents the slope of the function. Going up is positive in the y direction, and going right is positive in the x direction.  

Drawing a line through the 2 points gives a sneak peak on the full function to be graphed

PRO GAMER MOVE: function is y = 2x - 6

Answer:

It's A. (Locate the ordered pair (0, –6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points.)

Which expression is equivalent to 4n(6n + 2m)?
A 24n + 4n + 2m
B (4n + 2m) x 6n
C 24n2 + 8mn
D 10n2 + 6mn

Answers

Answer:

c maybe

Step-by-step explanation:

4n(6n+2m)

24n²+8mn

Answer: C, 24n²+8mn

Step-by-step explanation:

So because 4n is on the outside of the bracket, you have to times everything on the inside of the bracket by 4n.

So, you do:

4n×6n=24n² (4×6=24 and n×n=n²)

4n×2m=8mn (4×2=8 and n×m=mn)

Then you add 24n² to 8mn like this:

24n²+8mn

Hope this helps :)

Sam and her brother Nate are collecting stamps together. Nate has collected 5 more than twice the number of stamps Sam has collected. In total they have 26 stamps. Let n be the number of stamps that Sam has collected. Which of the following equations models this situation?
1. 2n+5=26
2. n+2n+5=26
3. 2n+5-n=26
4. n+2(n+5)= 26

Answers

Answer:

2. n(2n+5)=26.

Step-by-step explanation:

If Sam has n stamps, and Nate has 5 more than twice that amount, the equation would be: 2. n(2n+5)=26.

Given the figure below, find the values of x and z.

Answers

Answer:

x = 12

z = 101

Step-by-step explanation:

Hello There!

First lets find z

Well the angle that has a measure of 79 degrees and angle z are supplementary angles meaning that the sum of the two is 180

So we can find the missing angle by subtract the given angle (79 in this case) from 180

180 - 79 = 101 so z = 101

Now lets find x

The angle that has a measure of 79 degrees and the angle labeled (6x+7) are vertical angles

If you didn't know vertical angles are congruent

That being said lets create an equation to solve for x

79 = 6x + 7

now we solve for x

step 1 subtract 7 from each side by

7 - 7 cancels out

79 - 7 = 72

now we have 72 = 6x

step 2 divide each side by 6

72/6=12

6x/6=x

we're left with x = 12

how am i supposed to solve this ?

Answers

Answer:

Step-by-step explanation: so first you got to distribute the on both sides so like the 2 and the ten from there you just eliminate and do it like normal. I’m sorry I’m bad at at explaining it but I hoped it helped some how :)

PLS HELP ME ASAP PLS PLS PSL

Answers

Answer:

25

Step-by-step explanation:

What is the equation of the line that passes through the point (7,-6) and has a slope of -2?

Answers

Answer:

y=-2+8

Step-by-step explanation:

The answer is y=-2+8 because of course the slope has to be -2 as you stated in your Question. So all you have to do is change the Y-Intercept until you reach the point. Since the Slope is negative, the Y-Intercept will rise until you reach your point. You may double check my answer to see if it is right, it is up to you. If you find any fault in my answer please let me know. Have a good day!

Find the area of the circle. Round your answer to the nearest hundredth. diameter 3in

Answers

Area of circle = pi × r squared

A= 3.14....× (1.5×1.5)

A= 7.068583471

A= 7.07in( to nearest hundredth)

The percent of Tom winning a game is 20%, he played 30 games. How mang games did he lose?​

Answers

Answer:

He won 6 games and lost 24 games.

convert 50 percentage into fraction​

Answers

Answer:

50/100, simplified to 1/2

Step-by-step explanation:

50% means half of 1.

1/2=.5 which is half of 1.

1=100%

.5=50%

1/2=50%

Answer:

[tex] \displaystyle \frac{1}{2} [/tex]

Step-by-step explanation:

we are given a parcentage

we want to convert it into fraction

remember that,

[tex] \displaystyle \% = \frac{1}{100} [/tex]

therefore

substitute:

[tex] \displaystyle 50 \times \frac{1}{100} [/tex]

reduce fraction:

[tex] \displaystyle \cancel{50} \times \frac{1}{ \cancel{100} \: ^{2} }[/tex]

[tex] \displaystyle 1 \times \frac{1}{2} [/tex]

simplify multiplication:

[tex] \displaystyle \frac{1}{2} [/tex]

hence,

[tex] \displaystyle 50\% = \frac{1}{2} [/tex]


Find the total lateral area of the following
cone. Leave your answer in terms of a.
4 cm
3 cm
LA = ? cm2

Answers

Answer:

15π cm²

Step-by-step explanation:

The total lateral area of a cone

= πr√h² + r²

= √h² + r² = l

h = Height = 4cm

r = radius = 3cm

Hence:

= π × 3 √4² + 3²

= 3π × √16 + 9

= 3π × √25

= 3π × 5

= 15π cm²

Please helppp I need this for a better grade

Answers

Answer:

Step-by-step explanation:

Cos(x)=18/44=0.41

x=65.85

Solve 100x²+81=0 using square roots

Answers

the answer should be x=9i/10

Answer:

10

Step-by-step explanation:

The principal, real, root of:

100−−−√2

=10

All roots:

10

−10

100 is a perfect square

Find the distance between the points (–2,8) and (–2,3).

Answers

Answer:

I think it's 5

Step-by-step explanation:

I am not really sure but I tried I guess

I really need help please and thank you

Answers

Answer:

117 Degrees

Step-by-step explanation:

plz give brailiest, the 1 and 117 are the exact same angle

Other Questions
Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not Why should police be able to use peoples DNA without consent? NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is the relationship between tissues and organs?A. Tissues are made from a single, functional type of organ.B. Organs are made from a single, functional type of tissue.C. Organs are made from tissues with a similar structure and function.D. Tissues are made from organs with a similar structure and function. What is Isolated system Which describes the translation of ABCD to A'B'C'D'.A)translation 3 units right and 6 units uptranslation 6 units right and 3 units uptranslation 3 units left and 6 units downD)translation 6 units left and 3 units down The reticular formation ________.A) sets the rate of respiratory movementsB) contains nuclei and centers that regulate vital autonomic nervous system functionsC) relays somatic information to the ventral posterior nuclei of the thalamusD) regulates heart rate and force of contraction, and distribution of blood flowE) relays information from the spinal cord, the red nuclei, other midbrain centers, and the cerebral cortex to the vermis of the cerebellum Read the sentences.I want to be in London right now. I really want to see Big Ben and Buckingham Palace.Which sentence uses the subjunctive mood to express the ideas in the sentences?Going to London to see Big Ben and Buckingham Palace is a dream of mine.Going to London to see Big Ben and Buckingham Palace is a dream of mine. , ,I will go to London right now, and I will see Big Ben and Buckingham Palace.I will go to London right now, and I will see Big Ben and Buckingham Palace. , ,If I can get to London, I will see Big Ben and Buckingham Palace.If I can get to London, I will see Big Ben and Buckingham Palace. , ,If I were in London right now, I would go see Big Ben and Buckingham Palace.If I were in London right now, I would go see Big Ben and Buckingham Palace. , , Find the x and y intercept of this equation: -2x + 8y =4 write your solutions as a point in the form (x,y) How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . A human resources manager selected a random sample of 200 workers who donate to charity. The following table shows the distribution of the 200 workers. Count Type of worker Management Other white collar 96 50 S Blue collar 54 The manager conducts a goodness-of-fit test to determine whether the proportions of workers of these types are identical to the population proportions of workers donating to charity, which are 50 percent for management, 30 percent for other white-collar workers, and 20 percent for blue-collar workers. Which of the following statements must be true about the sample?A. The expected number of blue-collar workers donating to charity is less than 30. B. The expected number of management workers donating to charity is 100. C. The expected numbers of other white collar and blue-collar workers donating to charity are the same. D. The expected number of other white-collar workers donating to charity is 50 E. The combined expected numbers of other white collar and blue-collar workers donating to charity is greater than the expected number of management workers donating to charity. a = 8: b = ; C = 10. Can someone help me I have to find the missing angles