You watch a scientist dissolve some sugar in a liter of water and then place some of this solution into a dialysis bag, tying both ends shut. The she places the bag into a beaker of distilled water. What word best describes the solution outside of the bag?

Answers

Answer 1

Answer:

shoulda used ziploc?

Explanation:

Answer 2

Answer:

Hypotonic

Explanation:

When sugar is dissolved into the water, it adds molucules, making the water have a higher concentration. If you have a semipermable membrane between the two, it would create a process called osmosis. The hydrogen bonds would all go to the side with the higher concentration side, also known as the hypertonic side. The side with less bonds would be called the hypotonic side.


Related Questions

Which label in the graphic represents the energy that is released from glucose by cellular respiration?
Oxygen
Glucose
Energy stored as ATP
Carbon dioxide and water

Answers

Answer:

C) Energy stored as ATP

Explanation:

100% on edge

Which type of chromosomal disorders seems to have the greatest affect on a person’s health—disorders involving autosomes or sex chromosomes? Why do you think this might be the case? thanks in advance

Answers

Answer:

Disorders involving sex chromosomes.

we can take Turner's syndrome n klinefelter's syndrome as examples.

Differentiate between endangered species and extinct species (1 point 2 examples)

Answers

Answer:

Endangered: Still around but at risk of going extinct (example: tiger)Extinct: Gone forever (example: wooly mammoth)

Explanation:

An endangered species is one with a reduced population. These species can easily become extinct if all the remaining members die.

I'm always happy to help :)

Only ------ percent of the food eaten is turned into its own body. ​

Answers

Answer:

10%

Explanation:

there is a the rule that only 10% of the energy is transferred from one trophic level to the other.

this means that only 10% of the food an organism eats  is passed onto the next organism. eg only 10% of the energy in a plant is transferred to a rabbit that eats the plant. After that if  a wolf eats the rabbit only 10% of the energy of food will pass on to the wolf.

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

One reason cancer cells are easier to culture than normal cells extracted from an organism is that ________. Group of answer choices cancer cells grow in a more regulated fashion. cancer cells do not need to adhere to a substratum to grow. nutrient requirements for cancer cells are precisely defined. cancer cells are better models for demonstrating what happens in an intact organism.

Answers

Let's list the given options alphabetically to choose the appropriate answer.

One reason cancer cells are easier to culture than normal cells extracted from an organism is that ________. Group of answer choices

A. cancer cells grow in a more regulated fashion.

B. cancer cells do not need to adhere to a substratum to grow.

C. nutrient requirements for cancer cells are precisely defined.

D. cancer cells are better models for demonstrating what happens in an intact organism

Answer:

B.

Explanation:

Cancer cells are easier to culture in comparison to normal cells because cancer cells do not need to adhere to a substratum to grow.

As cancer cells are uncontrolled growth of cells and they do not require any substratum to grow and can easily grow to a culture while a normal cell require optimal conditions to grow in a culture.

Hence, the correct option is "B".

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Please help!

A. I only

B. II only

C. III only

D. I and III only

Answers

Answer:

a

Explanation:

my reason is that the capacity carrying is 35

Answer:

[tex]\boxed{\mathrm{A. \: I \ only}}[/tex]

Explanation:

The graph does not mention any seasons. The graph is not growing geometrically. For about 9 months the population has been about 35.

How many significant figures in 20.8cm?​

Answers

Answer:

[tex]\Huge \boxed{3}[/tex]

Explanation:

Significant figures include non-zero digits and in between zeros.

2    0   .   8

20.8 has 3 significant figures.

Answer:

[tex]\huge\boxed{3 \ significant \ figures}[/tex]

Explanation:

There are 3 significant figures in

 2   0   .   8

According to the rules of significant figures:

=> All non-zero digits are significant.

=> Zeroes that come between 2 non-zero digits are also significant.

So, 3 significant figures in the term 20.8 cm.

what is the answer to 9k=27

Answers

Answer:

K=3

Explanation:

We divide both sides by 9 which is 9k/9=27/9 then cancel 9 by 9 and by 9 once by 9 thrice.

What has a greater influence on protein levels? A. Protein degradation has a greater influence because they are denatured faster than the cell can produce them B. mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced C. mRNA destroyer concentration has a greater influence because mRNA is destroyed right after the proteins are produced D. Protein degradation has a greater influence because outside factors like antibiotics can cause it, and it is difficult to recover from

Answers

Answer: b

Explanation: i got the answer wrong and i’m looking at the results rn

Protein is being produced with the help of a process called translation in which mRNA gets translated to produce proteins. The translation is followed after the process of transcription of DNA to RNA.

The cause of the greater influence of protein levels has defined as follows:

The destruction of mRNA could greatly influence protein levels as mRNA is considered the source for proteins to get synthesized. This is because if mRNA gets destroyed, proteins would not have been produced at all. Thus, directly influences the levels of protein.

Thus, we can conclude that mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced. Hence, option (b) is the correct answer.

Learn more about protein here:

https://brainly.com/question/22241855

What will happen if external factors affect cell division in a group of cells placed in a culture dish? A) Anchorage dependence will cause the cells to attach to each other after dividing. B) Anchorage dependence will prevent the cells from dividing until they attach to the dish. C) Density-dependent inhibition will cause the cells to divide until the dish is completely full. D) Density-dependent inhibition will destroy large cells to create room for new cells.

Answers

Answer:

C) density-dependent inhibition will cause the cells to divide until the dish is completely full

Explanation:

Just took the exam

Illustrate the significance of membranes with the example of viruses

Answers

Answer:

Cell membrane encloses all the cell organelles.  In prokaryotes, membrane is absent and so membrane-bound cell organelles are also absent.

Significance of membrane can be explained with the help of viruses, as viruses lack cell membranes and that is why they require a host for living and uses the host's cell machinery to multiply.

Hence, cell membranes are important for living organisms to live and perform essential biological processes.

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

If Earth’s average surface temperature continues to change over the next 30 years at the same rate it changed between 1980 and 2010, the average temperature will most likely be around

Answers

Answer:

Its B....

Explanation:

Get that 100.

Examine the statement. A scientific theory can become a scientific law, but a scientific law cannot become a scientific theory. If the statement is true, select “True.” If it is false, select the option that is true 1.) True 2.) A scientific theory can become a scientific law, and a scientific law can become a scientific theory. 3.) A scientific law can become a scientific theory, but a scientific theory cannot become a scientific law. 4.) A scientific theory cannot become a scientific law, and a scientific law cannot become a scientific theory.

Answers

Answer:

It's true.

Explanation:

In general, a scientific law is the description of an observed phenomenon. It doesn't explain why the phenomenon exists or what causes it. The explanation of a phenomenon is called a scientific theory. It is a misconception that theories turn into laws with enough research.

When the scientists test the idea, they develop a theory by following a set of logical steps. A theory becomes a scientific law once it has been rigorously examined and accepted. Thus, option A is correct.

What A scientific theory can become a scientific law?

One prevalent fallacy is the idea that hypotheses eventually become laws. Despite the number of supporting examples, hypotheses do not actually become laws after repeated testing.

Scientific laws, like theories, explain occurrences that the scientific community has determined to be verifiably true. In general, laws explain what will occur in a specific circumstance and are proven by a mathematical equation, whereas theories explain how the phenomenon occurs.

Therefore, A testable explanation of a natural event is what constitutes a scientific hypothesis. The concept of gravity, for instance, explains why an apple always falls to the ground when.

Learn more about scientific theory here:

https://brainly.com/question/2375277

#SPJ2

Cómo explicarías tu que el soporte vegetal es más importante que los animales en un ecosistema?

Answers

Answer:

Las plantas son productores primarios, mientras que los animales son consumidores

Explanation:

La cadena alimenticia está conformada por niveles tróficos donde la energía fluye desde los niveles basales representados por la base de la pirámide, hasta los niveles superiores (pico de la pirámide). De este modo, los organismos representan diferentes eslabones de acuerdo a su posición en la cadena alimenticia. En el primer nivel se encuentran los productores primarios como lo son, por ejemplo, las plantas y algas de ambientes terrestres y acuáticos, respectivamente, siguiendo por los consumidores primarios (por ejemplo, especies hervívoras), continuando sucesivamente por los consumidores secundarios, terciarios y cuaternarios (especies carnívoras), los cuales se encuentran en posiciones cada vez más altas de la pirámide. No obstante, es importante indicar que existen ocasiones donde los consumidores superiores (ya sea secundarios, terciarios y cuaternarios) se alimentan de especies situadas por debajo de diferentes niveles no consecutivos e incluso también de especies pertenecientes al mismo nivel trófico, con lo cual encajando en más de una categoría y dificultando su clasificación en la cadena.

how do i explain this?

Answers

Answer:

Oxygen debt is a physiological phenomenon in which a person consume oxygen at fater rate that it replaced by new oxygen molecules.

As shown in the graph, oxygen debt occurs just after the end of exercise because oxygen is consumed at faster rate during exercise that leads to  increased respiration and body attempts to replace the used oxygen.

To overcome the problem of oxygen debt, a person should take rest that allows the body to replenish its oxygen supply.

What is conjunctivitis

Answers

Answer:

[tex] \underline{ \underline \orange{see \: below}}[/tex]

Explanation:

Conjunctivitis is an inflammation, infection of the conjunctiva. It is the most common ocular disease worldwide.It is characterized by a pink appearance because of subconjuctival blood vessels hemorrhage.

Simply, we can define it as :

Conjunctivitis ( pink eye ) is an inflammation or infection of the transparent membrane ( conjunctiva ) that lines your eyelid and covers the white part of your eyeball.

Pink eye is commonly caused by a bacterial or viral infection , an allergic reaction or in babies.

The most common pink eye symptoms include:

Redness in one or both eyesItchiness in one or both eyesA gritty feeling in one or both eyes

Hope I helped !

Best regards!

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

On May 18, 1980, Mount St. Helens in Washington State experienced a huge volcanic eruption after a magnitude 5.1 earthquake. During the eruption, hot ash and pumice poured down the west, south, and east sides of the mountain, melting the snow and ice at the top of the volcano and producing volcanic mudflows. Which type of process first occurred in the ecosystem around Mount St. Helens after it erupted?
primary succession
secondary succession
a climax community
species extinction

Answers

Answer:

Primary succession

Explanation:

Primary succession is mostly cause by volcanic eruption

The first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

What is a primary succession?

The term primary succession refers to the organisms that first occur in an ecosystem after a major event such as the volcanic eruption has taken place.

In this case, the first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

Learn more about primary succession: https://brainly.com/question/26675203

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

2. What happens in
terms of energy
when you hold a
craft stick and bend
it slightly?

Answers

Answer:

In a similar way a wooden tongue-depressor stick (like the kind used at the doctor's office) stores elastic potential energy when you bend it (though not if you break it). ... The elastic potential energy that was stored in the stick is transformed into movement, called kinetic energy.

Explanation:

Why might an ecosystem be better able to
cope with a season of forest tent caterpillar
outbreak than an increase in acidic
precipitation?

Answers

Answer: It contains leach aluminium.

Explanation:The ecological effect of acid rain are most Clearly seen in aquatic environment such as, stream, lakes and marshe where it can be harmful to fish and other wildlifes.

algae's general habitat?

Answers

Answer:

Algae is the process to describe that diverse group of photosynthetic lifeforms.

Explanation:

Algae is that environments process to the rivers and lakes to ponds waters an snow, algae living in the contain snow pigments that addition to the surrounding contain distinctive.

Algae is environment near inside water bodies, algae in many components in plants as stems and shoots or leaves nutrients water their body.

Algae like plants an special structure and algae is well defined body in the structure stems and leaves are photosynthetic organisms, algae are free living and symbolic relationship other organisms, there are many types of algae:- Green algae, blue and green algae ,red algae.

Green algae:- green algae to that conduct photosynthesis symbolic relation with higher organisms.

Blue and green algae:- this algae are include dams, river, lakes.

Red algae:- red algae is used in species found in freshwater ecosystem.

Algae is in unicellular and multicellular in environment nature.

The removal of waste products from the body is called

Answers

Answer:

It is called EXCRETION.

Explanation:

This is a process by which metabolic waste is removed from a living organism.

The excretory organs removes these waste.

Accumulation of these in the body is very harmful to our system.

Hope all these helps.

Which space exploration activity has most helped astronomers determine the age of the solar system?

collection of lunar rock samples

experiments performed on the International Space Station

placement of mirrors on the lunar surface

collection of deep space images by the Hubble telescope

Answers

The best answer about the space exploration activity that has helped astronomers determine the age of the solar system is :  Collection of Lunar rock samples ( option 1 )

There are several exploration activities in which astronomers partake when they visit the solar system and they include :

experiments on the space station, placement of mirrors on the lunar surface and the collection of space images

But to determine the age of the solar system, collection of rock samples is the best activity, because rocks (one of the first substances found in the solar system )  are as old as where they are found.

Hence the space exploration activity that has helped astronomers determine the age of the solar system is the collection of lunar rock samples

learn more : https://brainly.com/question/21668746

Answer:A

Explanation:Collection of lunar rock samples will help understand the moon more than the other options.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA
Other Questions
Suppose a 500 mb chart valid today at 12 Z indicates a large trough over the eastern US and a large ridge over the western US. An aircraft, flying in the vicinity of 18,000 ft altitude from west to east over the US at 12 Z today, will _____ altitude if the altimeter is not corrected. Group of answer choices what is ammonium nitrate why does working out make us feel good Pls answer ASAP TY. TY. TY. the ottoman empire was ruled by the emperor of Four letters are selected at random with replacement from the word MATHCOUNTS. What is the probability that the letters in the order they are selected will form the word MATH? A group of students conducted several trials of an experiment to study Newtons second law of motion. They concluded that tripling the mass required tripling the net force applied. What quantity were the students holding constant? A literaryWork whichextol one's virtues andaccomplishment is calledWhat If an advertisement is affiliated with a website's content, what might that suggest? A. that the information you find is biased B. that the advertisements were free C. that the advertisements financially support the site D. that the information you find will be entirely untrue I'm confused between some answers can someone clarify. Nitric oxide (NO) can be formed from nitrogen, hydrogen and oxygen in two steps. In the first step, nitrogen and hydrogen react to form ammonia: (g) (g) (g) In the second step, ammonia and oxygen react to form nitric oxide and water: (g) (g) (g) (g) Calculate the net change in enthalpy for the formation of one mole of nitric oxide from nitrogen, hydrogen and oxygen from these reactions. Round your answer to the nearest . Given that (-9,-8) is on graph of f(x), find the corresponding point for the function f(x)+2 Who should do the actual appraising of employees in an organization? Give your reasons for the choice you would make. what is the key term for at most 2. The fraction 84 by 98 in simplest form is What do you mean by the 4R principle to develop environment friendly habits? Japan, North Korea, and the Philippines each have a constitution. What role does each country's constitution play in organizing power in the government and shaping lives of citizens? You just won the lottery, which promises you $260,000 per year for the next 20 years, starting today (annuity due). If your discount rate is 7%, what is the present value of your winnings? Techwiz electronics makes a profit of $35 for each mp3 and $18 for each DVD last week techwiz sold a combined total of 118 mp3 and DVD players. Let x be the number of mp3 sold last week write an expression for the combined total profit (in dollars) made last week What does your choice of career as a health care professional indicate? 16Select the correct text in the passage.Which two sentences in this excerpt from John F. Kennedy's inaugural address demonstrate the use of antithesis as a rhetorical device?We observe today not a victory of party but a celebration of freedom-symbolizing an end as well as a beginning-signifying renewal as well aschange. For I have sworn before you and Almighty God the same solemn oath our forbears prescribed nearly a century and three-quarters ago.The world is very different now. For man holds in his mortal hands the power to abolish all forms of human poverty and all forms of human life.And yet the same revolutionary beliefs for which our forebears fought are still at issue around the globe-the belief that the rights of man come notfrom the generosity of the state but from the hand of God.We dare not forget today that we are the heirs of that first revolution. Let the word go forth from this time and place, to friend and foe alike, thatthe torch has been passed to a new generation of Americans-born in this century, tempered by war, disciplined by a hard and bitter peace, proudof our ancient heritage-and unwilling to witness or permit the slow undoing of those human rights to which this nation has always beencommitted, and to which we are committed today at home and around the world.ResetNext