1.
Marketing is one of the most important factors in determining the success of any fruit and vegetable farming enterprise. Marketing includes all the operations and decisions made by producers. These decisions range from deter-mining the most marketable crops for production to deciding how to best deliver quality produce to the consumers at a profit. However, contrary to popular belief, marketing does not begin after a crop is produced. Instead, marketing alternatives need to be considered even before production takes place.
2.
Recent environmental and food safety concerns in the United States produce sector have brought about increasing interest in organic fruit and vegetable production as an alternative to traditional fruit and vegetable enterprises. As a result, the production and marketing of organic crops has expanded steadily during the 1980s. However, as more organic producers enter the industry and it becomes more and more competitive, existing producers are forced to become better growers and more effective marketers.
In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen
Answer:
Due to less concentration of carbondioxide gas.
Explanation:
Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.
If there will be changes on trophic levels, what will be the effects on the ecosystem?
Answer:
It can significantly alter the homeostasis of the ecosystem
Explanation:
The trophic level is the position that occupies a given organism/ population/species in the food web. In a food web, the trophic levels are organized into a first category (formed by primary producers, e.g., plants), a second level (primary consumers, e.g., herbivores), and subsequent categories (predators, e.g., carnivores). The abrupt change in the number of organisms belonging to the same trophic level generally has a negative effect on the ecosystem by modifying the trophic structure of communities. For example, decreasing the number of producers will produce a decrease in the number of primary consumers, thereby altering the homeostasis (equilibrium) of the entire ecosystem. On some occasions, it may eventually lead to the extinction of populations and species.
Which of the following describes a negative feedback loop?
Answer:
Which of the following describes a negative feedback loop?
Explanation:
where is option ?
Which relationship is an example of commensalim?
once, more than once, or not once, more than once, or not at all.
This group of questions refers to molecules of the following substances.
(A) Cytochrome
(B) FADH
(C) NAD
(D) NADP
(E) Oxygen (02)
Answer:
a
Explanation:
Two molecules of ATP are generated for every one molecule of glucose in ... a cell needs more NADPH than it does ribose 5-phosphate. ... Practice: Which one of the following is NOT a potential fate of pyruvate ? a.
what is the dakota access pipeline
Answer: The Dakota Access Pipeline (DAPL) or Bakken pipeline is a 1,172-mile-long underground oil pipeline in the United States. It begins in the oil fields of the Bakken formation in northwest North Dakota and continues through South Dakota and Iowa to an oil terminal near Patoka, Illinois.
Explanation:
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
Can someone pleeaseeee helpppp!! I’ll mark the brainliest
Answer:
i think its C im not sure but normally in my opinion that would be correct
Answer:
natural selection: black moths had a higher chance of survival since they were more camouflaged from the pollution
Explanation:
What are chromosomes? How are they different between prokaryotes and eukaryotes?
Answer: A chromosome is a long DNA molecule with part or all of the genetic material of an organism. The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not
Explanation:
Chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
Chromosome:
It is a long thread of DNA molecule as a part of genetic material of all living organisms.
In prokaryotes, DNA is not very much compacted.Only one chromosome is usually scene in prokaryotes.In Eukaryotes, Chromosome are very compacted and form an special structure.Multiple chromosomes are found in Eukaryotes.
Therefore, chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
To know more about Chromosomes,
https://brainly.com/question/296477
What is the definition of "earth overshoot day?"
Answer: Earth Overshoot Day is the calculated illustrative calendar date on which humanity's resource consumption for the year exceeds Earth’s capacity to regenerate those resources that year. The term "overshoot" represents the level by which human population overshoots the sustainable amount of resources on Earth.
When does gamete production occur?
An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as
Answer:
This organism is best classified as an autotroph.
Explanation:
Autotrophs can make their own food.
Which statement best describes the overall chang
O One cell becomes two cells that have identical
OOne cell becomes two cells that have different
O Two cells become tWo cells that have identical
O Two cells become two cells that have different
Answer:number one
Explanation:
Which of the following is true about CO_2CO
2
?
A
It does not have much effect on the climate.
B
It is a greenhouse gas.
C
Very little CO_2CO
2
is being emitted now.
D
If we cut CO_2CO
2
emissions by half, the temperature will stop rising.
Answer:
B.
Explanation:
It has a huge impact on the environment
It is being emitted in large amounts
And if we cut our carbon emissions in half it would delay the risk of raising the global temperature of 1.5 degrees Celsius but half of it would still pumped into the atmosphere along with the carbon dioxide already in the atmosphere.
But it is a greenhouse gas because it helps trap the heat remaining in Earth's atmosphere which is why the Earth is warming.
CO2 is a greenhouse gas.
what are greenhouse gases?
Greenhouse gases are gases in the atmosphere that affect the energy balance of the planet. The greenhouse effect is caused by them. Carbon dioxide (CO2), methane, and nitrous oxide, the most well-known greenhouse gases, can all be present in low concentrations in the environment.
The greenhouse gases in the atmosphere trap heat and warm the earth.
Carbon dioxide, methane, nitrous oxide, and water vapor (all of which exist naturally) are the principal greenhouse gases, as are fluorinated gases (which are synthetic).
Carbon dioxide (CO2) is released into the atmosphere as a result of the combustion of fossil fuels (coal, natural gas, and oil), solid waste, trees, and other biological materials, as well as chemical processes (e.g., manufacture of cement). As part of the biological carbon cycle, carbon dioxide is absorbed by plants and released from the atmosphere.
hence, CO2 is a greenhouse gas.
To know more about greenhouse gas here
https://brainly.com/question/14131369
#SPJ2
Mistakes are sometimes made in duplicating or transmitting genetic information. These mistakes are called
Answer:
Mutation
Explanation:
Mutation is any alteration or change in the genetic sequence of a gene caused by mutagens (substances) or mistakes during replication of genetic sequences.
A mutation occurs in the gene from time to time, although, the cell has protocols in place to put them under control if they occur. However, when DNA or a gene is being copied and transferred to offsprings, there is bound for mistakes called MUTATION to occur.
Classical biotechnology begins around 1800,
O True
False
Answer:
True
Explanation:
Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron
Answer:
Oxygen
Explanation:
-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.
-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.
A farmer has been trying to increase his crop yield for the last 10 years by
adding about 25% more fertilizer to his crops than he needs. What will most
likely result from this action?
Select one:
a. Increased crop yields.
b. Air pollution from the excess fertilizers
c. Soil degradation form the excess fertilizers
d. The additional fertilizer will have little to no impact.
Answer:
The correct answer is - b. Air pollution from the excess fertilizers
Explanation:
In long term using excess amount of fertilizer than requirement will lead to several condition such a soil acidity, soil degradation, soil leacing, eutrophication of waterways and many but more improtant is green house gases and air pollution.
Using the excess amount of fertilizer does not help in increasing crop yield but gives negative impact. Using fertilizer more than requirement wil lead to release of toxic and harmful gases in atomosphere and fuming.
What are the components of blood
Explanation:
Blood is a specialized body fluid. It has four main components:
plasma, red blood cells, white blood cells, and platelets.Blood has many different functions, including: transporting oxygen and nutrients to the lungs and tissues.
Please help me on this question
I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.
What is true about the water sample?
Choose 1 answer:
(Choice A)
A
It is basic.
(Choice B)
B
It is acidic.
(Choice C)
C
It is neutral.
(Choice D)
D
It is both basic and acidic.
Answer:
it is Basic brooooooo. No B NOT C AND NOT D. oNly A
The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)
Why does plastic flow only occur below 50 meters of ice?
A. It is cold enough below that much ice to cause plastic flow.
B. Basal slip only occurs at depths below 50 meters.
C. Fifty meters of ice can block enough sun to cause plastic flow.
D. It takes the weight of that much ice to cause the plastic flow.
Answer:
d
Explanation:
it takes the weight of that much ice to cause the plastic to flow.
Answer:
D
Explanation:
Because _________
is not a reason to reject frozen food.
A. ice crystals appear on the product or package
B. fluids or frozen liquids appear in case bottoms
C. there are water stains on the package
D. a similar or identical product is available in freeze-dried form
Answer:
D a similar or identical product is available in freeze-dried form
Answer:
D just took the test
Explanation:
Butanol was used in the production of:
O Cordite
O Nitroglycerin
O Fizzy beverages
Synthetic rubber
Answer:
Synthetic rubber.
Explanation:
Polymerization can be defined as a type of chemical reaction in which molecules that are relatively small in size chemically combine to form a huge chain of molecules.
Simply stated, polymerization refers to a chemical reaction where two or more smaller molecules react to produce larger molecules of the same network or repetitive structural units.
In polymerization, the relatively small molecules are generally referred to as monomers while the larger molecules they produce are known as polymers.
Butanol was used in the production of synthetic (artificial) rubber through a fermentation process.
which of the following are part of the central nervous system?
Answer:
The central nervous system is made up of the brain and spinal cord
Explanation:
ion if that's the answer you were looking for but here go.
what does the phrase "science is not done" mean?
Answer:
yrfquwrfbliueiurviurnfr
Explanation:
that means i do not know what that means
Answer quickly please
How do roundworms differ from earthworms?
A. They have a cylindrical body.
B. They have a body that is tapered at both ends.
C. They reproduce sexually.
D. They are not divided into segments.
Answer:
Key difference: Earthworms, Tapeworms and Roundworms are long and cylindrical shaped worms. The basic difference between them is that Earthworms are segmented invertebrates belonging to the phylum Annelida, Tapeworms are flatworms belonging to the phylum Platyhelminthes, and Roundworms are parasitic worms belonging to the phylum Nematoda.
Explanation:
So: A?
Answer:
A
Explanation:
They have a cylindrical body.
Have a great day and good luck
ALOT OF POINTS PLEASE HELP :)
How did humankind discover the presence of DNA?
Answer:
The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.
Explanation:
The baker mixed yeast in the dough and kept it away for the night , The next morning it had risen high up , Explain how this happened
Explanation:
Maybe this can help.
In bread making (or special yeasted cakes), the yeast organisms expel carbon dioxide as they feed off of sugars. As the dough rises and proofs, carbon dioxide is formed; this is why the dough volume increases.
Which best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.
It is oxygen rich
What do you mean by arteries?
The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.
What is oxygenated blood?
Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.
To learn more about arteries here
https://brainly.com/question/3306673
#SPJ2