14+x = -9

X equals what?

Answers

Answer 1

Answer:

x=−23

Step-by-step explanation:

14+x=−9

Step 1: Simplify both sides of the equation.

x+14=−9

Step 2: Subtract 14 from both sides.

x+14−14=−9−14

x=−23

Answer 2

Answer:

-23

Step-by-step explanation:

14+x =-9

-14      -14

x = -23


Related Questions

Convert the following repeating decimal to a fraction in simplest form.
.71

Answers

Answer:

71/100

Explanation:

As you can see, the decimal ends at the hundredths place, so the fraction is 71/100. Its simple! If the number end at the tenths, hundredths, or thousandths, just take that number and do it like this! 38/1,000

Hope this helped! ;)

Find two consecutive even integers such that the sum of the smaller and 3 times the larger is 330
I am so stuck please any one help

Answers

Answer:

The 2 numbers = 81 and 83

Step-by-step explanation:

As, one number = x

The other, because it's an even number and consecutive = x + 2

So the larger numbef here is x + 2

And they are saying 3 times x + 2 plus x = 330

So let's solve!

3 times x + 2 = 3(x+2) = 3x + 6

So we will add it to x = (3x + 6) +(x) = 4x + 6

So they are saying the sum of them will be 330

So, 4x + 6 = 330

4x = 330 - 6

4x = 324

x = 324/4

x = 81

So x is the first number = 81

And the second is x + 2 = 81 + 2 = 83

So the 2 numbers are 81, 83

Lets check!

3 times the bigger number = 83 x 3 = 249

We will add it to 81 and we will get 330

So, 249 + 81 = 330

So the answer is right

I'll give u brainliest if right ​

Answers

Answer:i think its a or c

Step-by-step explanation:

Зу – х = -5
-7х + 4 = –18
Solve each system of equation using elimination

Answers

Answer:

(1)xy=-5-3

-8ans

Step-by-step explanation:

(2) -3x =-18

-15ans

Evaluate b/a−1.2 when a=4 and b=12

Answers

Answer:

3-1.2=1.8

Step-by-step explanation:

12/4=3-1.2=1.8

ago
7
.
15
6
7
10. Which of the following could be the
perimeters of the three squares below?
A. 12 ft, 16 ft and 20 ft
B. 20 ft, 16 ft and 24 ft
C. 40 ft, 80 ft and 120 ft
D. 16 f1, 24 ft and 28 ft
Maneuvering the Middle LLC, 2017

Answers

Answer:

where are the squares?

Step-by-step explanation:

What dvision problem can be represented using the number line?
A) 10/3 divided by 5/3. B) 5/3 divided by 10/3. C)2 divided by 5/3. D)2 divided by 10/3

Answers

Answer:

C

Step-by-step explanation:

The manager of a symphony in a large city wants to investigate music preferences for adults and students in the city. Let pA represent the population proportion of adults who live in the city who prefer pop music. Let pS represent the population proportion of students who live in the city who prefer pop music. Random samples of 200 adults from the city and 200 students from the city will be selected. Which of the following is the best interpretation of P(pˆA−pˆS>0)≈0.022 ?

Answers

Answer:

Answer E

Step-by-step explanation

The statement gives a probability of approximately 0.022 for the difference in sample proportions, pˆA−pˆS, being greater than 0.

The interpretation of the given expression is "the difference between the population proportion of adults and the population proportion of students who prefer pop music is approximately 0.022".

Given :

pA is the population proportion of adults.pS is the population proportion of students.The total number of adults is 200 and the total number of students is also 200.

The following steps can be used in order to determine the best interpretation of the given expression:

Step 1 - According to the given data, pA is the population proportion of adults who live in the city who prefer pop music.

Step 2 - Also given that pS is the population proportion of students who live in the city who prefer pop music.

Step 3 - So, the interpretation of the given expression is "the difference between the population proportion of adults and the population proportion of students who prefer pop music is approximately 0.022".

Therefore, the correct option is A).

For more information, refer to the link given below:

https://brainly.com/question/8069952

Help please ill give brainliest

Answers

Answer:

Red line is y=0.8x

Blue line is y=0.8x-3.2

Step-by-step explanation:

Hurry up please I have 27 minutes to anwser 25 guestions

Answers

It would be the second choice. Add by 25.

Answer:

C. The relationship between the quantities is: add 25.

Step-by-step explanation:

1x = 25y,

2x = 25 + 25 = 50y

3x = 50 + 25 = 75y

4x = 75 + 25 = 100y

Note:

As you can see, every time the number goes up on the chart, it goes up by 25 and you can find that out by just simply adding 25 to the first number and seeing if it matches up with the next, (which I did above).

Ms. Speer's spent a total of $120 while online shopping . Out of the total, $84 was spent just on Amazon. The rest was spent on apple. Write and equation to determine how much Ms. Speer spent at Apple. Write your equation below and determine how much she spent at Apple.

Answers

Answer:

a + 84 = 120

Step-by-step explanation:

Let a = how much $ was spent on Apple

a + 84 = 120

a = 36

ILL GIVE BRAINLIEST ! Choose all the expressions that are equivalent to 3(2 + 11) *

32 + 311
3(2) + 3(11)
3(2) + 11
6 + 11
6 + 33
3 + 22

Answers

Answer:

6+33 and 3(2)+3(11) are the correct answers.

Step-by-step explanation:

Solve for x. Enter the solutions from least to greatest.
(x+15)^2-10=0

Answers

Answer:

lesser x = -1.84lesser x = -8.16

Step-by-step explanation:

Given the expression

[tex]\left(x+5\right)^2-10=0[/tex]

Add 10 to both sides

[tex]\left(x+5\right)^2-10+10=0+10[/tex]

Simplify

[tex]\left(x+5\right)^2=10[/tex]

[tex]\mathrm{For\:}\left(g\left(x\right)\right)^2=f\left(a\right)\mathrm{\:the\:solutions\:are\:}g\left(x\right)=\sqrt{f\left(a\right)},\:\:-\sqrt{f\left(a\right)}[/tex]

solve

[tex]x+5=\sqrt{10}[/tex]

Subtract 5 from both sides

[tex]x+5-5=\sqrt{10}-5[/tex]

[tex]x=\sqrt{10}-5[/tex]

[tex]x=-1.8[/tex]

so

[tex]x+5=-\sqrt{10}[/tex]

Subtract 5 from both sides

[tex]x+5-5=-\sqrt{10}-5[/tex]

Simplify

[tex]x=-\sqrt{10}-5[/tex]

[tex]\:x=-8.2[/tex]

As -1.84 > -8.16

so

lesser x = -1.84lesser x = -8.16

Melanie works at a frozen yogurt stand after school. The stand sells fruit and yogurt smoothies for $3.00 each and soft-serve cones for $2.00 each. On a hot summer day, the stand sold 12 more smoothies than soft-serve cones for total sales of $206. Which of the following systems of equations could be used to find s
s
, the number of smoothies, and c
c
, the number of cones the shop sold that day?

Answers

Answer:

3s+2c=206

s=c+12

Step-by-step explanation:

3.00(smothies,s) + 2.00(cones,c) = $206 (total)

s,smoothies = c,cones + 12

help please this has to be done ​

Answers

Answer:

100

Step-by-step explanation:

a triangle is 180, so 180-58-22 is your answer

Can someone help me please

Answers

Answer: A) m = 9, n = 9

==========================================================

Explanation:

This is a 45-45-90 right triangle. Any triangle of this form is isosceles, where the two legs are the same length. In this case, m and n are those two legs. So m = n.

We can then apply the Pythagorean theorem to say

a^2 + b^2 = c^2

m^2 + n^2 = (9*sqrt(2))^2

m^2 + m^2 = 9^2*(sqrt(2))^2

2m^2 = 81*2

m^2 = (81*2)/2

m^2 = 81

m = sqrt(81)

m = 9

As a shortcut, the hypotenuse of a 45-45-90 triangle is equal to sqrt(2) times the length of either leg. If m is the length of the leg, then m*sqrt(2) is the length of the hypotenuse. So in a sense, we take this thought process backwards to go from a hypotenuse 9*sqrt(2) to a leg length of 9.

In the diagram below, what is the approximate length of the minor arc DE?
A. 79 cm
120 F
B. 39 cm
25 cm
C. 26 cm
D. 52 cm

Answers

Answer: its D. 52 cm

Step-by-step explanation: Just got it good

The gardener charged $0.50 per plant and $75 to plant all them

Answers

Answer:  The question is The Gardener charged $0.50 per plant and a flat payment of $75. Which function represents this scenario?

The answer is 0.50x-75

The total cost will be the product of the gardener charged and the number of plants. The total cost is $ 37.5

What is multiplication?

It is also known as the product. If the object n is given to m times then we just simply multiply them.

The gardener charged $ 0.50 per plant and $75 to plant all of them.

Let X be the gardener charged and Y be the number of plants.

The total cost will be the product of the gardener charged and the number of plants. That can be written as

Total cost = X × Y

Total cost = 0.50 × 75

Total cost = $ 37.5

More about the multiplication link is given below.

https://brainly.com/question/19943359

Jose was playing a basketball shooting game in the arcade. He made 15 shots and missed 25 shots. What is the percentage of shots Jose made in the basketball game?

help pls :(

Answers

Answer:

37.5/38(rounded)

Step-by-step explanation:

Answer:

37.5%

Step-by-step explanation:

15 + 25 = 40

15/40 = 37.5%

15

40      x 100% = 37.5%

Sorry if wrong! Plz mark brainiest if correct :D Have a great day Luv!

-Bee

Look at the pictures and solve. WILL GIVE BRAINIEST
Drag the tiles to the correct boxes to complete the pairs. Not all tiles will be used.
Match each graph to the equation of its line.

Answers

Answer:

1. y = 4x - 4

2. y = x + 2

3. y = -2x - 4

4. y = -x + 2

Step-by-step explanation:

Slope-intercept form is y = mx+b. As we know, m is the slope and b is the y-intercept. We need to find the slope and y-intercept and put them in the equation. Slope is rise over run, so we just count up then over until we get to an intersection. For the y-intercept, we look where the line crosses the y-axis.

50 points !!!!!!!!!!!!!! answer the question please help
I will give bairnleast

Answers

[tex]\boxed{\large{\bold{\textbf{\textsf{{\color{blue}{Answer}}}}}}:)}[/tex]

Shape and pattern are the element of art and principal of designdid the artist manipulated to create texture on this scripture.

Answer:

Shape and pattern {final answer}

Step-by-step explanation:

The element of art and principal of design did the artist manipulate to create texture on this sculpture is shape and pattern. This option best suits for most of the sculptures. Therefore, the last option is the required answer.

1. 2x + 5 = 9
2. 9 + 3x = 18
3. 2x - 16 54
4. 2(x + 1) = 8
5. 4m-316
(pls help me to answer this)​

Answers

Answer:

1. 2

2. 3

3. 35

4. 3

5. m=79

1. 2(2) + 5 = 9
2. 9 + 3(3) = 18
3. 2(35) - 16= 54
4. 2(3+ 1) = 8
5. Actually, number 5 doesn’t provide an answer to solve for.

Glad I could help and also, can you please mark my answer as the brainliest answer?
Thank you so much!

Rationalize the denominator and simplify. √a+1 - 2 / √a+1 + 2

Answers

Answer:

5+a-4√a+1 / a-3

The rationalization of given expression is a+5-4√(a+1)/(a+5).

What is Rationalization?

Rationalization can be considered as the process used to eliminate a radical or an imaginary number from the denominator of an algebraic fraction. That is, remove the radicals in a fraction so that the denominator only contains a rational number.

The given expression is √(a+1)-2/√(a+1)+2.

Multiply both numerator and denominator by (a+1)-2, we get

√(a+1)-2×(a+1)-2/√(a+1)+2×(a+1)-2

= (√(a+1)-2)²/(√(a+1))²+2²

= (√(a+1))²-2×√(a+1)×2+2²/a+1+4

= a+1-4√(a+1)+4/(a+5)

= a+5-4√(a+1)/(a+5)

Therefore, the rationalization of given expression is a+5-4√(a+1)/(a+5).

Learn more about the rationalization here:

https://brainly.com/question/1980047.

#SPJ2

Help plz I’m giving a lot of points

And no nonsense answers plz

Answers

Answer:

it is a positive number because she was rising if she had been going down then the number would have become negative.

Step-by-step explanation:

it is a positive number because she was rising,

however, if she was going down the number would become negative.

A side of the triangle below has been extended to form an exterior angle of 164". Find
the value of x.
1649

Answers

Given:

Measure of exterior angle = 164°

The measure of opposite interior angles are x° and 53°.

To find:

The value of x.

Solution:

According to the Exterior Angle Theorem, in a triangle the measure of an exterior angles is always equal to the sum of measures of two opposite interior angles.

Using Exterior Angle Theorem, we get

[tex]x^\circ+53^\circ=164^\circ[/tex]

[tex]x^\circ=164^\circ-53^\circ[/tex]

[tex]x^\circ=111^\circ[/tex]

[tex]x=111[/tex]

Therefore, the value of x is 111.

By rounding each of 9.85, 3.875 and 6.3 to the nearest whole number work out an estimate for the answer to 9.85^3 / 3.875 + 6.3^2

Answers

Answer:

286.

Step-by-step explanation:

9.85^3 /3.875 + 6.3^2

= 10^3/ 4 + 6^2

= 1000/4 + 36

=250 + 36

=286.

Rewrite the equation 6x – 9y = 12 in terms of y.

Answers

Answer:

Step-by-step explanation:

6x - 9y = 12

subtract 6x from both sides

-9y = 12 - 6x

divide both sides by -9

y = -4/3 + 2/3x

or

y = 2/3x - 4/3

The equation 6x – 9y = 12 written in terms of y is; y = (2/3)x - 4/3

We are required to write the equation 6x – 9y = 12 in terms of y.

Rewriting the equation 6x – 9y = 12 in terms of y is as follows;

6x – 9y = 12

6x - 12 = 9y

Divide through by 9 so that we have;

y = (2/3)x - 4/3

Read More on Change of formula subject:

https://brainly.com/question/9584546

How do I do this please help me

Answers

Answer: I think it might be (0,8)

Step-by-step explanation:

The temperature in a town is 34.1°F during the day and -8.6°F at night. Find the difference in the temperatures.​

Answers

Answer:

the difference is 25.5

Step-by-step explanation:

34.1 - 8.6 = 25.5

[tex]42.7^{\circ}F[/tex]

Subtract the number with the smallest value from the number with the biggest value to determine the difference between two numbers.

Temperature in a town during the day [tex]=34.1^{\circ}F[/tex]

Temperature in a town during the night [tex]=-8.6^{\circ}F[/tex]

Therefore,

Difference in temperatures [tex]=34.1-(-8.6)[/tex]

                                            [tex]=42.7^{\circ}F[/tex]

For more information:

https://brainly.com/question/20671719?referrer=searchResults

We have to fill in all the boxes in order for me to submit. PLEASE HELP!!

Answers

Answer:

2 and 3 maybe?

Step-by-step explanation:

Other Questions
A Material Safety Data Sheet (MSDS) is a document that provides information about how to handle and safely dispose ofhazardous chemicals.sharps.infected body tissue.surgical equipment. Change the following sentence into passive form1. What question did they raise in the discussion?2. They are going to build that bridge in 20183. They used to build houses of wood 4. How many trees can we save for every ton of recycled newsprint ?5. We can make many things from wood 6. If I were you. I wouldnt accept his invitation 7. They must do it before I come 8. Where do they keep a large collection of books?9. They can find the books they want in the library 10. What do they keep a large collection of the books for ?Thank you very much What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... What are the outcomes of the ice cap melting? Choose all that apply.1. Light cannot be reflected back to the atmosphere2. Sea level rises3. Absorption of solar radiation leads to increase in ocean temperature4. Ocean remains unaffected paid rent of Rs.25000 by cheque. make journal entry m2 = by the .m1 = by the .m3 = by the . please help me with thisanswer choiceThis system has infinitely many solutions.This system has exactly one solution.This system has no solution.(5, 28) and (0, 0) please answer correctly no trolls! Gregory knows that Triangle A B C is reflected onto Triangle A prime B prime C prime. Which statement about the figures is true?If Gregory draws the segment with endpoints A and A, then the midpoint will lie on the line of reflection.If Gregory draws the segment with endpoints B and C, then the midpoint will be on the line of reflection.Points A and B are equidistant from the line of reflection.Line segment A B will be perpendicular to the line of reflection. Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? Rule-of-thumb budgeting is budgeting that's popular with the hospitality and tourism industry because it's so effective. trueorfalse can someone please answer these and explain how you did it2x - 7 = 117x + 1 = 223x - 8 = 228x +5 = 45 write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC A store receives customer satisfaction ratings that range between 0 and 100. In the first 13 ratings the store received, the average customer satisfaction rating was 75. What is the least value the store can receive for the 14th rating and still be able to have an average of at least 84 for the first 21 ratings? What is the main purpose of foreign aid? Help plz... give you brainliest for who ever answers, plz need help. Financial reports are created and used to evaluate the financial performance of the business. Which function is responsible for creating the reports Describe the religions of the early Indigenous peoples.