Calculate the correlation coefficient, r, for the data below.

Answers

Answer 1

This question is incomplete, the complete question is;

Calculate the correlation coefficient, r, for the data below.

X = -10  -8  -1  -4  -6  -7  -5  -3  -2  -9

Y = -15  -13  4  -4  -7  -11  -6  -2  1  -13

Answer: the correlation coefficient, r, for the data is 0.9896

Step-by-step explanation:

Given the data in the question;

correlation coefficient r = ?

we know that, C_Coeff is;

r = [ (Zn(∑xy) - (∑x)(∑y) ] / [ √[( n∑x² - (∑x)²) ( n∑y² - (∑y)²)] ]

so ;

       X        Y        X²        Y²        XY

     -10     -15       100      225      150

     -8      -13        64       169       104

     -1         4          1        16           -4

     -4       -4         16       16           16

     -6       -7         36      49          42

     -7       -11         49      121         77

     -5       -6         25      36         30

     -3       -2          9         4            6

     -2       1            4         1            -2

     -9      -13         81       169         117

∑   -55     -66      385     806        536

now we substitute our values into the formula

r = [ (10×536 - (-55)(-66) ] / [ √[( 10×385 - (-55)²) ( 10×806 - (-66)²)] ]

r = 1730 / √( 825 × 3704 )

r = 1730 / √3055800

r = 1730 / 1748.0846

r = 0.9896

Therefore the correlation coefficient, r, for the data is 0.9896


Related Questions

-4 > x - 3 find x in the equation

Answers

Answer:

X= -1

Step-by-step explanation:

PLEASE ANSWER THIS ASAP, I WILL BE GIVING YOU A THANKS!

Answers

Answer:

I would say D. There is no logical explanation for the final answer but there is for everything else.

For A: Makes sense because 3x-2 are in parenthesis outside a number so you can multiply.

For B: Makes sense because you are allowed to add/subtract like terms but in this case only subtracting would make sense, (which is what they did) since you want to get all the like terms on one side.

For C: Makes sense because you are trying to simplify the equation, and they are both like terms (they are both numbers that have no letter attached to them) and they are on the opposite side making them able to be simplified.

For D: No idea what the point is.

When using a number line, in which direction should you move when subtracting a negative value?

Answers

Answer:

LEFT

Step-by-step explanation:

Answer:

Move to the right when you're subtracting a negative number.

1. A store sold 700 motorcycles last year. This year the store sold 820 motorcycles. What is the percent change in the number of motorcycles sold from las year to this year?​

Answers

Answer:

120 or 120%, hope this helps!

Step-by-step explanation:

800 adults were surveyed to find out how many notes per week they cook dinner 60% indicated that they cooked dinner more than four nights at per week based on the results of the survey how many adults out of a group of 2000 to cooked dinner more than four nights per week

Answers

Answer:

1200

Step-by-step explanation:

60                 x

-              =    -

100               800

There are 2 ways to solve this.

1) 800 x 60= 48,000

Divide by 100= 480

x=480

2)  Multiply 60 by 8.

Now there are another 2 ways to go.

1) 480        x

   -        =   -

  800        2000

OR

2) 60            x

   -          =    -

   100           2000

I recommend the second option for both. It is easier. The second option allows you to find and equal ratio, with less of the hassle.  

To get 2000, 100 must be multiplied by 20. So.... multiply 60 by 20 to get a equal ratio.

Your answer is 1200. Meaning 1200 adults cooked dinner more than four nights per week.

I hope this helps you significantly

~~~LampteyJ

Answer:

1200

Step-by-step explanation:

418/36 as a mixed number

HELP PLEASE

Answers

Answer:

11 11/18

Step-by-step explanation: a quick search

Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5, and a drink for $2. Write an expression for the total cost of the trip to the movies. Then find the total cost.

Answers

Answer:

Tyree and all of his friends get 1 ticket for $7. Next they all get 1 snack for $5. Then they all get a drink for $2. So:

1=7

1=5

1=2

Then you take each person (which there are five of then) and you times all five people by 7, 5, 2.

5 x 7=35

5 x 5=25

5 x 2=10

After that you add it all together:

35 plus 25=60

60 plus 10=70

Step-by-step explanation:

your welcome

Answer:

Im not sure if it ment, Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5 (meaning only one snack), and a drink for $2. (Meaning only one drink) or if it ment Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5 (meaning everyone got a snack), and a drink for $2(meaning everyone got a drink). So i did the math for both of them, if they only got 5 tickets, one snack, and one drink, it would be 42 (the math problem is 35 + 2 + 5). if they got 5 tickets, 5 snacks, and 5 drinks, it would be 70(the math problem is 35 + 25 + 10). Hope this helps!

Pls give the right answers
Pls help
Pls help
Pls help

Answers

Answer:

H

Step-by-step explanation:

Because I’m decimal if it is negative the greater the number in negative the less it is

1-i need to mix 25% mineral spirits to the varnish i am using what ratio of spirit to varnish am i using? 2-if i use 240 ml of varnish what quantity of mineral spirits will i need in ml ? 3-Robison's tapestries all measure 1.5m x 1m wide. Express the proportion of the tapestries' heights to width using whole numbers. Give the answer in ration.

Answers

Answer:

(1) The required ratio of spirit to varnish is 1:3.

(2) You need 80 ml of mineral spirit.

(3) The ratio of tapestries' heights to width is 3:2.

Step-by-step explanation:

(1) If you need to mix 25% mineral spirit to the varnish, then the solution would contain 25% mineral spirit and 75% varnish.

So, [tex]\frac{spirit}{varnish}=\frac{25}{75}[/tex]

                  [tex]=\frac{1}{3}[/tex]

Thus, The required ratio of spirit to varnish is 1:3.

(2) If you use 240ml of varnish, then this quantity is 75% of the total solution or ration of varnish to the total solution will be 3:4.

Let [tex]x[/tex] be the quantity of total solution.

Then, [tex]240:x=3:4[/tex].

⇒[tex]\frac{240}{x}=\frac{3}{4}[/tex]

⇒[tex]3x=240*4[/tex]

⇒[tex]x=\frac{240*4}{3}[/tex]

⇒[tex]x=320[/tex]

That is, total solution is 320 ml.

Now, Spirit = Total solution - Varnish

⇒Spirit = 320ml-240ml

⇒Spirit = 80ml

Hence, if you use 240 ml of varnish, you need 80 ml of mineral spirit.

(3) Robison's tapestries all measure 1.5m long and 1m wide. First, we express dimensions in whole numbers by multiplying them by 10.

Then, dimensions are 15m long and 10m wide.

Now, Height : Width = 15:10

⇒[tex]\frac{Height}{Width} =\frac{15}{10}[/tex]

⇒[tex]\frac{Height}{Width} =\frac{3}{2}[/tex]

Hence, the ratio of tapestries' heights to width is 3:2.

please solve question in picture branoist to first and correct​

Answers

Answer:

The correct answer is Option 3: 12y

Step-by-step explanation:

A polynomial term is usually made of a variable and a co-efficient.

Like terms are those terms that have the same variables i.e. x and 44x are like terms.

Given expression is:

[tex]6y-2y+8y[/tex]

All the terms have only y which means that all three terms are alike.

The coefficients of like terms are added or subtracted according to their sign.

[tex]6y-2y+8y[/tex] = 12y

Hence,

The correct answer is Option 3: 12y

Question 1
Find the missing angle to the nearest degree.
36
14
degrees

Answers

Answer:

23°

Step-by-step explanation:

Let the missing angle be x

Reference angle = missing angle = x

Opposite side to x = 14

Hypotenuse = 36

Applying trigonometric ratio, we have:

[tex] sin(x) = \frac{14}{36} [/tex]

[tex] x = sin^{-1}(\frac{14}{36}) [/tex]

x = 23° (to the nearest degree)

A line has a slope of a and has a y-intercept of (0,b). Which equation represents this line?
A. y-b=a(x-0)
B. y+b=a(x-0)
C. y-0=a(x-b)
D. y-0=a(x+b)

PLEASE HELP GIVING 50 POINTS!!!

Answers

Step-by-step explanation:

General line equation: y = mx + c, where m is the slope of the line and c is the y-intercept.

We have y = ax + b.

=> y - b = ax

=> y - b = a(x - 0).

The answer is option A.

Answer:

A

[tex]general \: equation \: of \: line \\ y = mx + c \\ from \: the \: data \: given \\ m = a \\ c = b \\ y = ax + b \\ y - b = ax \\ y - b = a(x - 0)[/tex]

Write an expression that represents the number of shells in pile 2.

Answers

Answer:

2

Step-by-step explanation:

4/2=2

Plss answer
i will give brainliest

Answers

Answer:

sorry im doing a challenge but i will have someone answer it    

Step-by-step explanation:

The meaning of an inequality depends on the __________________of the inequality sign.

Answers

Answer:

Denpeds on the left hand side of nagetive of the inequality sign

the food pantry distribution 10 oz bags of rice if 3 5 lb bags are donated to the pantry how many 10 ounce bags can be made ​

Answers

Answer:

24 bags can be made from three 5 pounds bags.

Step-by-step explanation:

Given that:

Three 5 pound bags are donated.

Total weight of bags = 3*5 = 15 pounds

We know that:

1 pound = 16 ounces

15 pounds = 16*15 = 240 ounces

A bag weighs 10 ounces.

Number of bags = [tex]\frac{240}{10}[/tex]

Number of bags = 24 bags

Hence,

24 bags can be made from three 5 pounds bags.

What is the length of side EF in the triangle? Please give a step by step explanation, I'm having lots of trouble finding the solution. Thank you!

Answers

Answer:

EF = 8.8 cm

Step-by-step explanation:

In the given right angled ΔDEF, DE is the hypotenuse while EF and DF are adjacent sides. So that applying the Pythagoras theorem, we have;

[tex]/hyp/^{2}[/tex] = [tex]/adj1/^{2}[/tex] + [tex]/adj2/^{2}[/tex]

[tex]/DE/^{2}[/tex] = [tex]/EF/^{2}[/tex] + [tex]/DF/^{2}[/tex]

[tex]/16.2/^{2}[/tex] = [tex]/EF/^{2}[/tex] + [tex]/13.6/^{2}[/tex]

262.44 = [tex]/EF/^{2}[/tex] + 184.96

[tex]/EF/^{2}[/tex] = 262.44 - 184.96

          = 77.48

EF = [tex]\sqrt{77.48}[/tex]

     = 8.8023

EF = 8.8 cm

The length of side EF is 8.8 cm.

Look at at pic attached! Pls hurry :( 21 points

Answers

Answer:

C option

Step-by-step explanation:

bcz root of 121 is 11. then 2/3 +11 will give you a rational number.

Answer:

2/7 + square root of 121 (the third one)

Step-by-step explanation:

a rational number is a number where if you write it as a fraction, both the numerator and denominator are integers (numbers like 1 and 2 but not like 3.4 or 5.6)

the equation simplified a bit looks like this:

2/7 + 11/1

anddd so all the numbers are integers which means that expression is correct :3

Find the solution to the system of equations: x + 3y = 7 and 2x + 4y = 8

1. Isolate x in the first equation:

2. Substitute the value for x into the second equation:

3. Solve for y:







4. Substitute y into either original equation:

5. Write the solution as an ordered pair:





x = 7 – 3y

2(7 – 3y) + 4y = 8

14 – 6y + 4y = 8

14 – 2y = 8

–2y = –6

y = 3

x + 3(3) = 7

(, )

Answers

Answer:

The solution to the system of equation is: (-2,3)

Step-by-step explanation:

We need to find the solution to the system of equations: x + 3y = 7 and 2x + 4y = 8

I am placing steps for each point given

1. Isolate x in the first equation:

First equation is:

x+3y=7

Isolating x:

x=7-3y

2. Substitute the value for x into the second equation:

Second equation is:

2x+4y=8

Putting value of x: x=7-3y

2(7-3y)+4y=8

3. Solve for y:

2(7-3y)+4y=8

Multiply 2 with terms inside the bracket

14-6y+4y=8

-2y=8-14

-2y=-6

y=-6/-2

y=3

So, we get value of y: y=3

4. Substitute y into either original equation:

Putting value of y: y=3 in equation 1

x+3y=7

x+3(3)=7

x+9=7

x=7-9

x=-2

So, we get value of x: x=-2

5. Write the solution as an ordered pair:

After solving the equation we get:

x = -2 and y = 3

The ordered pair is: (-2,3)

Answer:

-2,3

Step-by-step explanation:

Isolate x in the first equation:

Substitute the value for x into the second equation:

Solve for y

Please give me brainiest

The feet of a poem can easily be compared to _______.

a heartbeat
footsteps
a musical beat
a drum beat

Answers

A footsteps I believe

Answer:

its a heartbeat.

Step-by-step explanation:

sorry for late answer, just answering for any future people.

Kenny drank 37 ounces of milk during the
day. How many cups of milk did he drink?

Answers

Answer:

4.625

Step-by-step explanation:

that is the answer

I will give you a good amount of points if you answer this correct​

Answers

Answer:

I think the answer is B. The equation has infinitely many solutions.

Step-by-step explanation:

4(3x + 4) = 15x + 12 - 3x + 4

*group like terms so 4(3x+4) = 15x - 3x + 12 + 4

*add similar elements 15x - 3x = 12x

*add the numbers 12 + 4 = 16

*Expand to 12x + 16 - 16 = 12x + 16 - 16

*You simplify 12x = 12x

*Subtract 12x from both sides

*Then Simplify which is 0

Which means Both sides are equal to 0

True for all X

I GIVEEE BRAILILSTTTTTTTT

Answers

Answer:

umumumuykik.iu.fg

Step-by-step explanation:

lui;iou;uyfluylfuy;lui;uy;

Find the arc length of the semicircle. 8

Answers

Answer:

π×8² =

201.0619298297

arc length formular = π ×r²

Question 16 please help me

Answers

The answer is 32.8 this is because using the Pythagorean it’s a”

Which equation produces the values in the table?
O y= 4x
O y=4+x
O y=1/4x
Oy=4 - x

Answers

Answer:

Step-by-step explanation: It’s C thank me later

The equation produces the values in the table is y = x/4

What is an equation?

Mathematically, an equation can be defined as a statement that supports the equality of two expressions, which are connected by the equals sign “=”.

For example, 2x – 5 = 13.

Given is table (attached) we need to determine an equation that produces the values in the table,

So, seeing the value it is much that the value of x are the 4 times of the values of y,

So, we can write,

4y = x

or, y = x/4

Hence, the equation produces the values in the table is y = x/4

Learn more about equation, click;

https://brainly.com/question/29657983

#SPJ7

QR is parallel to ST Rs is parallel TU QS is congruent to SU

prove QRS is congruent to STU

Answers

Answer:

hope my answer is helpful to you

plz mark me as brainlist and also follow me

As QR is parallel to ST Rs is parallel TU QS is congruent to SU the measure of their included angle is also same ∠QRS ≅ ∠STU.

What is congruency?

We know two similar planer figures are congruent when we have sides or angles or both that are the same as the corresponding sides or angles or both.

Given, Line segment QR is parallel to line segment ST.

Line segment RS is parallel to line segment TU, And line segment QS is similar to line segment SU.

So, The included angle of two pairs of parallel lines will also be the same as

line segment QS is similar to line segment SU.

∴ ∠QRS is similar to ∠STU.

learn more about congruency here :

https://brainly.com/question/7888063

#SPJ5

A standard train ticket in a certain city costs $1.50 per ride. People who use the train also have the option of purchasing a frequent rider pass for $17.25 per month. With the pass, a ticket costs only $0.75 per ride. How many train rides a month make the frequent rider pass a better deal than standard train tickets?

Answers

Just off the bat 17$is 12 rides and then 17.25 +0.75 is 18 so 13 rides

x = number of rides per month.

Without the pass, the cost per ride is 2.00 per ride.

With the pass, the cost per ride is 1.25 per ride plus 15.75 per month.

You want to know at what number of rides does the cost per ride using the pass become cheaper than the cost per ride without using the pass.

The formula for total cost is as follows:

without the pass:

C1 = 2*x

with the pass:

C2 = 15.75 + 1.25*x

You want to know when C2 becomes less than C1.

C2 < C1 is the inequality equation you are looking for.

Since C2 = 15.75 + 1.25*x, and C1 = 2*x, this equation becomes:

15.75 + 1.25*x < 2*x

Subtract 1.25*x from both sides of this equation to get:

15.75 < 2*x - 1.25*x which becomes:

15.75 < .75*x

Divide both sides of this equation by .75*x to get:

15.75/.75 < x

Simplify to get:

21 < x

21 < x is the same as x > 21.

Your answer is the C2 becomes cheaper than C1 when x > 21.

If you make x = 21, then:

C1 = 2*21 = 42
C2 = 15.75 + 1.25*21 = 15.75 + 26.25 = 42

They are equal.

If you make x = 22, then:

C1 = 2*22 = 44
C2 = 15.75 + 1.25*22 = 15.75 + 27.5 = 43.25

43.25 is cheaper than 44 so C2 is cheaper than C1, confirming that the equation is good.

Find the missing value in the percent statement using a proportion.
______ is 75% of 4.

Answers

Answer: 3

Step-by-step explanation: Hope I helped

Multiply the polynomials: (x – 4)(x2 + 2x – 5)

Question 16 options:

A)

x3 + 6x2+ 3x – 20

B)

x3 + 6x2 + 3x + 20

C)

x3 – 2x2 – 13x – 20

D)

x3 – 2x2 – 13x + 20
Question 17 (5 points)
Subtract: (4x3 + 9xy + 8y) – (3x3 + 5xy – 8y)
Question 17 options:

A)

7x3 + 14xy

B)

x3 + 4xy

C)

7x3 + 14xy + 16y

D)

x3 + 4xy + 16y
Question 18 (5 points)
What are the real solutions to the equation 5x2 + 29x + 20 = 0?
Question 18 options:

A)

x = –5, x = 4∕5

B)

x = –4∕5, x = 5

C)

x = 4∕5, x = 5

Answers

Step-by-step explanation:

Hey there!

Given;

[tex] = (x - 4)( {x}^{2} + 2x - 5)[/tex]

[tex] = x( {x}^{2} + 2x - 5) - 4( {x}^{2} + 2x - 5)[/tex]

[tex] = {x}^{3} + 2 {x}^{2} - 5x - 4 {x}^{2} - 8x + 20[/tex]

[tex] = {x}^{3} - 2 {x}^{2} - 13x + 20[/tex]

Therefore, Option D is correct answer.

Q.no.

Given;

[tex] =( 4 {x}^{3} + 9xy + 8y) - (3 {x}^{3} + 5xy - 8y)[/tex]

[tex] = 4 {x}^{3} + 9xy + 8y - 3 {x}^{3} - 5xy + 8y[/tex]

[tex] = {x}^{3} + 4xy + 16y[/tex]

Therefore, answer is Option D.

Qno.

Given;

[tex]5 {x}^{2} + 29x + 20 = 0[/tex]

[tex]5 {x}^{2} + (25 + 4)x + 20 = 0[/tex]

[tex]5 {x}^{2} + 25x + 4x + 20 = 0[/tex]

[tex]5x(x + 5) + 4(x + 5) = 0[/tex]

(5x + 4)(x + 5) =0

Either (5x+4)= 0,

5x = -4

X = -4/5

Or, X+5 = 0

X = -5.

Therefore, X= -5, -4/5.

Hope it helps....

Other Questions
can you please help me:) write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Need answers for #3 please hep Identify the number of solutions for the equation below: What is (-3,4) (5,-2) in slope intercept form? How did the use of paper help contribute to the spread of Islam? The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.What is the best use of an atomic model to explain the charge of the particles in Thomsons beams?An atoms negative particles are surrounded by positive matter, so the positive particles are easier to remove.An atoms positive particles are surrounded by negative matter, so the negative particles are easier to remove.An atoms smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.An atoms larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove. PLS HURRY!!Can you tell how many different notes are played at a particular time (chords)? for manic by conan gray What is the common ratio of the sequence?-2, 6, -18, 54....-3-238 Tina Jones is a dancer specializing in Latin dance styles. She always wanted to have her own dance studio where she could teach dancing to young and old alike. In 2006, she opened her first dance studio, Electric Diva, in Madison Triangle. It was a great choice as a business location because its well-connected by highways to most places in the city. She leased the space for three years. Her initial investment included a good sound system, cheerful interior design, and strong flooring. To raise capital for the business, Tina turned to her brother-in-law, Philip. Philip made half the financial investment. He manages the accounts and social media needs of the business. He has a 30% share in Trishas business. Together, they expanded the business to three dance studios in the city and plan to open franchises in other cities. Which of the following is the BEST clue to the theme of astory? T/F: The hardships/challenges faced by the colonist were minimal in comparison to the opportunities gained. if the radius is 14cmand The perimeter of the sector is 57.32cm.what is the size of the angle? I need help my teacher never taught me well Iesha is headed to the grocery store. She needs to buy eggs. If a dozen (12) eggs cost $10.68 how much will one egg cost at the same rate?