Can somebody please help me with all the question?

Can Somebody Please Help Me With All The Question?

Answers

Answer 1

Answer:

no

Explanation:


Related Questions

HELP IT DUE NOW !!!!!!!!!!!!!!!
An area that is in the early stages of secondary succession will typically contain

rock lichens.

evergreen trees.

perennial shrubs.

annual grasses.

Answers

Perennial Shrubs I know it is late.

anyone know the answer??????????????????????????????????

Answers

Answer:

The first one is the answer

Explanation:

Kingdom: Animal

Genus: Leucocephalus

Species: Haliaeetus

Lymphocytes are generally categorized as

T-cells and B-cells.

basophils and neutrophils.

granulocytes and eosinophils.

macrophages and dendritic cells.

Answers

Answer:

A

Explanation:

On the Indonesian island of Bali, about 3/4 of the feral (stray) cats have a stumpy tail while only 1/4 of the cats have a regular long tail. When you did some experiments and picked out a bunch of random stumpy-tailed cats and mated them, they had some stumpy-tailed kittens and some regular-tailed kittens. You did the same with the the regular tailed cats, but they always had only regular tailed kittens. What does this tell you about the genotype of the regular tailed cats

Answers

Answer:

That stumpy tail is the dominant trait, while the regular long tail is the recessive trait.

Explanation:

Due to technical problems, you will find the complete explanation in the attached files

Approximately time passes between B and F

Answers

Answer:

14 days

Explanation:

It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.

The major goal of the Social Gospel movement in the late 19th and early 20th century was to: Promote the spread of Protestantism in United States territories Promote the spread of Protestantism in United States territories Draw the attention of Protestant churches to the plight of the urban poor Draw the attention of Protestant churches to the plight of the urban poor Encourage support for Charles Darwin's theory of biological evolution Encourage support for Charles Darwin's theory of biological evolution Spread Nativist sentiments

Answers

Answer:

Draw the attention of Protestant churches to the plight of the urban poor.

Explanation:

The main aim and goal of the Social Gospel movement was to bring attention of Protestant churches to the difficult and dangerous solution of the urban poor. The main purpose of this movement is to combat injustice, suffering and poverty in the society. This movement started to solve the social problems such as social injustice, poverty, crime, economic inequality, alcoholism, Racial tensions slums, clean environment and child labor etc. This movement begun in the 20th century and has a great effects on he progressive-minded reformers.

Which one is the true answer

Answers

Answer:
B
Explaination:

Is the thermos considered a conductor or insulator?

Answers

Answer:

no

Explanation:

Insulator is the answer

How does factory farming impact workers, specifically undocumented people and people of color?

Answers

Answer:

Driven by rigid contracts set forth by their corporate partners, factory farms knowingly jeopardize workers' health in order to maximize profits. A large percentage of factory farm workers are black and brown peoples including migrant workers from Mexico and other parts of Latin America.

Explanation:

Pl help it’s for a grade

Answers

Answer:

B: four fundamental forces

Explanation:

According to the present understanding, there are four fundamental interactions or forces: gravitation, electromagnetism, the weak interaction, and the strong interaction.

(Source: Wikipedia)

The correct anwser would be anwser B hope this helps! :)

Which of the following improves your range of motion and helps prevent
injuries?
A. A healthy body composition.
B. Strong flexibility,
C. Strong cardio-respiratory endurance.
D. A good sense of balance.
SUBMIT

Answers

Answer:

B. strong flexibility

Explanation:

Being flexible allows your body to move in a fuller range of motion and can help prevent injury because you aren't putting as much strain on yourself.

If the DNA sequence is GCTCAATTCGACCTA, the complementary RNA
sequence created during transcription is

Answers

Answer:

CGAGTTAAGCTGGAT

Explanation:

thymine pairs with adenine and guanine pairs with cytosine

T-A

G-C

When a blood clot breaks free and blocks a vessel leading to the brain a _______________________ can happen.

Answers

Answer:

a stroke can happen

Explanation:

A stroke can happen, right?

The diagram below represents the circulation of air above Earth's surface at a coastal location during the day and at night.
This local air movement is best described as an example of
1.
conduction between Earth's surface and the atmosphere above it
2.
condensation of water vapor during the day, and evaporation of water during the night
3.
convection resulting from temperature and pressure differences above land and water
4.
greater radiation from the warmer ocean during the day and from the warmer land at night
Submit Answer

Answers

Answer:

3. convection resulting from temperature and pressure differences above land and water

Explanation:

Due to the the difference between the ability of land and to water to absorb and radiate heat energy, the land gets heated up by the sun more quickly than water during the hot afternoons. As a result, the air above the land surface gets heated up more quickly than that above water. Warm air being less dense than cold air will rise above to atmosphere creating a low pressure area on land. On the other hand, air above water is not heated up as quickly, thus the dense cooler air over water will rush in and replace the warm air that has risen above the land surface.

At night, the land cools off more easily than water, hence the air above the land surface is cooler. On the other, water does not lose heat as quickly as the land, hence the air above the water surface is warmer than that over land. Warm air over the water surface will rise above, while colder air from land will replace it.

High levels and long periods of stress can increase a person's risk for many diseases
True
False​

Answers

Answer:

This is true many people can get many diseases from stress.

Answer:

True, go on this for your assessment  I commented on ur other post too, https://quizlet.com/341036936/chapter-11-lesson-3-flash-cards/

Explanation:

callme 9473242403 0nly g​

Answers

what would we talk about bae?

Answer:

you mean guys or gils hmm

Explanation:

What's does the term origin time mean in earth science

Answers

Answer:

Well depending on context it can mean different things, I could mean one of these three thing, choose the one you think is the most suitable,

(1) The birth, existence, or beginning; starting point. (2) The cause; that which causes something to arise. (3) That which acts as the source or that which from where something is derived.

Select the conditions caused by fungi.


rust

yellow mosaic

barley yellow dwarf

blight

Stewart’s wilt

holcus spot

stalk rot

Answers

The answers are the following:
-Rust
- yellow mosaic
- blight
-Stalk rot

—Evidence—
•] Rusts are plant diseases caused by pathogenic fungi of the order Pucciniales.

•] Wheat yellow mosaic (usually called wheat spindle streak mosaic) is caused by a soilborne virus which also is transmitted by the soilborne fungus, Polymyxa graminis.

•] Blight spreads by fungal spores that are carried by insects, wind, water and animals from infected plants, and then deposited on soil. The disease requires moisture to progress, so when dew or rain comes in contact with fungal spores in the soil, they reproduce.

•] Fusarium stalk rot, primarily caused by the fungus Fusarium verticilliodes, is a common disease in the Midwest. This fungus also causes Fusarium ear rot and can infect roots, stalks, and leaf nodes. It is most common in hot, dry years.

Heat energy is the transfer of _______ energy. A. chemical B. thermal C. electrical D. mechanical PLS HELP

Answers

Mechanical I think I’m not sure sorry
B, thermal. Chemical would do more with chemicals (surprise) reacting with each other. Electrical has to do with electrons moving. Mechanical would be due to movement (think of how you’d get sweaty after working out).

There are 450 calories in 100 g of trail mix. If you burn 30 calories in 10 minutes of walking, how much trail mix should you eat to replenish the energy you spend walking for 2 hours?

Answers

Answer:

to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten

Explanation:

Firstly, let us calculate the number of calories burnt in 2 hours

in 10 minutes; 30 calories are burnt

∴ in 1 minute 30/10  calories are burnt = 3 calories are burnt

2 hours = 120 minute

∴ in 120 minutes 3 × 120 = 360 calories are burnt.

Next, let us calculate the amount of trail mix that contains 360 calories

100g of trail mix = 450 calories

450 calories = 100 g

1 calory = 100/450

∴ 360 calories = 360 × (100/450)

=  360 × 0.222 = 80g

∴ to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten

Hanan ate a meal that consisted of rice, dal, fish and fried potatoes. Explain the process of digestion of the food with reference to the parts and enzymes involved in the digestive system.

Answers

Answer: A digestive system can be defined as a system which is made up of the alimentary canal and the associated glands and organs which produce some of the enzyme- rich secretions that bring about digestion. The process of digestion of food Hanan are, is discussed below.

Explanation:

The food taken by Hanan consist of carbohydrates (rice, potatoes ), protein( fish, dal) , fats and oil( fish, fried potatoes). The digestion of the food taken passess through a long tube ( alimentary canal) which stretches from the mouth through oesophagus to stomach, intestines and down to the anus.

In the MOUTH, the following occurs:

--> The food is cut and grinded into smaller pieces by the help of the teeth.

--> the enzyme ptyalin acts on the carbohydrate part of the food converting it to complex sugar.

--> the food is mixed with saliva, with the help of the tongue, is rolled into a bolus which is then swallowed.

At the STOMACH, food enters through the peristaltic movements of the oesophagus, The following occurs:

--> The muscular walls of the stomach contract and relax forcefully, thus churning the food.

--> Gastric juice( consists of pepsin, renin and dilute hydrochloric acid). Dilute hydrochloric acid activates pepsinogen to pepsin which digests proteins to polypeptides.

--> Food remains in the stomach for three to four hours. By this time, it is a thick, creamy fluid called chyme which them moves to the duodenum (small intestine).

At the SMALL INTESTINE, digestion occurs at the first part called the duodenum, and later part called the ILEUM.

--> Several substances are secreted into the duodenum from the pancreas( pancreatic juice) and liver( bile), the accessory organs of digestion.

--> pancreatic juice contains three important enzymes whose activities include:

• Amylopsin: Breaks down complex sugar to maltose

• Trypsin: breaks down protein into peptides

• Lipase: Breaks down fat into carboxylic acids and glycerol (end product of digestion of fat).

--> Bile from the liver, adds water to the chyme, emulsifies fat and neutralise the action of dilute hydrochloric.

At the ILEUM, intestinal juice is produced by special cells of the small intestine. Their actions include:

• maltase: this acts on maltose converting it to glucose( which is the end product of carbohydrate digestion).

• erepsin: This acts on peptides converting it to amino acids( which is the end product of protein digestion).

Absorption takes place at the small intestine.

Write a hypothesis showing the effect of nutrients in the soil on the growth rate of the tomato plant

Answers

Hypothesis:

As the tomato plant grows, nitrogen levels in the soil will decrease

A hypothesis showing the effect of nutrients in the soil on the growth rate of the tomato plant is As the tomato plant grows, nitrogen levels in the soil will decrease.

What is soil ?

The  soil is  a mixture of different components which comprises  minerals, organic matter, and living organisms, it is a loose sediment,  Moreover, there are different types of soil like Clay Soil, Sandy soil, Loamy Soil, Silt Soil

soil  it is One of the most crucial components of the biosphere, this particle is composed of 45% minerals, 50% spaces  and 5% organic matter, the soil involve in  many important functions such as Providing a growth medium for the plants, Acts a modifier of the earth’s atmosphere

The formation of soil involve in different process , it can be formed   by weathering of rocks and the weathering of Solid rock  occur in three way like Mechanical Weathering, Chemical Weathering, Biological Weathering

For more details regarding soil, visit

brainly.com/question/8937689

#SPJ2

cohesion is a property water.Which of the following is NOT an example of cohesion

a.water is attracted to the sides of a glass cylinder
b.water strider can walk on water
c.water forming a drop on a penny
d.water molecules are attracted to each other

Answers

Answer:

A po kasi nga kapag ang tubig ay naisalin sa isang baso minsan ang tubig ay dumidikit sa baso tama diba kaya naman ang sagot ay A baka naman brainliest naman jan:)

Water is attracted to the sides of a glass cylinder is an example of cohesion.

What do you mean by cohesion?

Cohesion means sticking together. If your group of friends heads to the lunchroom as a team and sits all together, you're demonstrating strong cohesion.

Cohesion allows for the development of surface tension, the capacity of a substance to withstand being ruptured when placed under tension or stress.

Cohesion refers to the attraction of molecules for other molecules of the same kind, and water molecules have strong cohesive forces thanks to their ability to form hydrogen bonds with one another.

Learn more about cohesion:

https://brainly.com/question/29598400

#SPJ2

In pea plants, yellow pea color (Y) is dominant over green pea color (y).
What would the phenotype be if the genotype is Yy.

Answers

Answer:

So we know that yellow pea is dominant over green pea

then offspring might be 75% yellow pea and 25% green pea. Since yellow pea is dominant I feel like it will still be Y because its dominant

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

Answers

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

Can someone help me with his please?

Answers

4N to the left
5N to the left
0N
9N to the right

match the following
(i) Stem tuber (a) minerals

(ii) Conditioned Reflex (b) Blue green algae

(iii) Blood Circulation (c) potato

(iv) Pancreas (d) chlorosis

(v) Autotrophs (e) Pavlov's Experiment

(vi) Active transport (f) Insulin

(g) William Harvey​

Answers

Answer:

Stem tuber ---- Potato

Conditioned reflex ---- Pavlov's experiment

Blood circulation ---- William harvey

Pancreas ---- Insulin

Autotrophs ------ Blue green algae

Active transport ---- Minerals

Note: Chlorosis has no matching item in the list. Explanation is given below.

Explanation:

Stem tubers are plants which store their food in their stems. Potatoes are stem tubers.

Conditioned reflex is a reflex is acquired gradually by training in association with specific repeated external stimuli. For example, the Russian psychologist Ivan Pavlov's  performed experiments on conditioned reflex using a dog. He demonstrated that a dog will salivate on the sound of a bell even if there is no food given to it if the ringing of the bell preceded every feeding session of the dog.

William Harvey discovered the circulation of blood and the function of the heart .

The islets of Langerhans found in the Pancreas secretes the hormone, insulin.

Autotrophs are organisms which are able to manufacture their own food, Blue green algae are examples of autotrophs.

Active transport is transport which requires expenditure of energy and occurs against the concentration gradient of the substance being transported. Because the concentration of minerals in the soil are in very low concentration, active transport is used by the root hair cells carrier proteins to move mineral ions across the membrane into the cell against the concentration gradient. ATP hydrolysis provides the energy for this process.

Chlorosis is a disease which appears as the yellowing of leaves in plants and in human a green tinging of the skin which is caused by the deficiency of minerals especially iron and manganese.

Why are enzymes important for chemical
reactions?

Answers

Answer:

Enzymes greatly increase the reaction rate, or catalyze them.

Explanation:

Without them, many of us would not be alive, because the reactions wouldn't be fast enough!

What is an example of a learned behavioral adaptation?
O camouflage
O hunting
O hibernation
O migration

Answers

Answer:

Hunting

Explanation:

Camouflage is a hereditary physical aspect, whereas hibernation and migration are instinctual. Hunting is a learned behavior as it is not as ingrained as the other two and is not automatically done.

P.S. at first I read the answer choices to the tune of "O, christmas tree"

what is formed during photosynthesis​

Answers

Answer:

Glucose and oxygen is produced

Explanation:

oxygen is usually released as a by-product and the glucose made is converted to starch and stored in leaves

plus ATP molecules are formed from excess light energy and is converted to a high energy chemical compound

Other Questions
the product of two and a number, divided by five Multiple Choice Which of the following events would cause local competition for fuel oil in a small American town? imposing tariffs drought hurricane sporting events How did Louisianans respond to the Great Depression?A Voters rallied behind Herbert Hoover and the Republican Party to revive the economy.B More people deposited their money in the bank, seeking to protect their savings.C Local governments encouraged farmers to grow more food crops and fewer cash crops.D Investors poured more money into the stock market, seeking to regain what they had lost. 14. What did the Cuban missile crisis result in? a = F/m is an explanation ofin Physics 7/100 - 6/100= 1/100 right? Please please help its urgent Which of the following actions would decrease global warming?Select one:Decreasing the amount of methane in the air.Increasing the amount of oxygen in the air.Increasing the amount of water vapor in the air.Decreasing the amount of nitrogen in the air. which statement best supports the idea that crabs might eat seahorses? A. seahorses are really fish. B. seahorses are slow swimmers. C. some seahorses have damaged tails. D. some seahorses are found in seaweed. A taste-testing survey of Zing Farms showed that 2/3 people surveyed preferred the taste of veggie burgers to regular burgers. If 90,000 people were in the survey , how many favored veggie burgers? How many chose regular burgers ? Heredity is the passage of what from parent to offspring? a. Genetic material b. Oxygenated blood c. Digestive enzymes d. Connective tissue what trait only appears when a organism is a homzygous x(x - 1) -y (-1) =0 I need help on this 1+s=3 Which of the following is a complex sentence?A. I went swimming because it was hot. B. Because it was hot. C. I went swimming and it was hot.D. And it was hot. A right triangle is shown. An altitude is drawn to form a right angle with the opposite side and split the side into lengths of 3 and 3. What is the value of x? One-third StartRoot 2 EndRoot units One-half StartRoot 3 EndRoot units 2 StartRoot 3 EndRoot units 3 StartRoot 2 EndRoot units 23Name the positions of the presiding officers of the House of Representatives and the Senate.Explain which one has more power I need help on this and if you the first person to get it right i will give you BRANLIST What does Gatsby do at his party in chapter 3? PLS HURRY ITS DUE IN LIKE AND HOURThanks An analogy is a type of, Literal languageContext languageTechnical languageFigurative language