Differences among individuals of the same species are known as:
Different offsprings, from the same parents.
A.Natural Selection
B.Adaptations
C.Variations
D.Fittness
Answer:
variation is the answer that is genetic variation
The quickest rate at which a population can grow is its ___________________________.
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Fat cells are expandable. How does this structure relate to a fat cell's function?
A) Fat cells store energy for the body to use later, so being
expandable would help with storage.
B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.
C) Fall cells protect organs, so being expandable can help with cushioning.
D) Fat cells do not expand
Answer:
Explanation:
d
Describe how the complete oxidation of 1 mole of glucose can generate 32 ATPs. You should include i) products of anaerobic glycolysis with numbers, ii) products of Krebs cycles with numbers, and iii) process of ATP synthesis by electron transport chain via NADH/FADH and H ions
Answer:
Explanation:
1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP
For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.
The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.
While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.
How does water help drive the rock cycle?
A. It is abundant on Earth's surface.
B. It is an agent of weathering and erosion.
C. It helps Earth maintain a relatively constant temperature.
D. It maintains a liquid state in a relatively narrow range of temperatures
ap3x
Los autosomas son aquellos cromosomas que se caracterizan por
Answer:
Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.
Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).
Which of the following describes the products of mitosis?
two unique cells
one cell identical to the parent
cell death
two daughter cells that have identical DNA to the parent
Answer:
The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.
Explanation:
Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?
1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium
Answer:
3) passive transport
Explanation:
Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).
Answer: moves particles from on area of low concentration to an area of high concentration
Explanation: Active transport differs from passive transport because active transport
can only move particles into the cell.
does not require energy to transport particles.
moves particles from an area of low concentration to an area of high concentration.
depends on the random movements of particles to carry them across the membrane.
EDG2023
D)
transgenically reduced
12)
The energy required for a seedling to push up out of the ground comes from
A)
muscle tissue.
B)
photosynthesis.
C)
food stored in the seed.
D
other plants
Answer:
In the seed is the energy required for a seedling to push up out of the ground comes from food stored in the seed.
Refer to the chart in Figure 10: Effects of Surface Gravity, to see what someone would weigh on different planets.
If you weighed 100 pounds on Earth, you would weigh _______ pounds on Saturn.
94.8
91.6
88.4
120.5
pleas help !!!
I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural
If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?
Answer:
True
Explanation:
Because for each death someone is born
It's like 1+1+1-1-1=1
The answer is the same
What is flight initiation distance FID
Answer:
Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.
hope this helps<3
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis
Answer:
the company has also announced plans
Which of the following is not a true statement of the lungs?
Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.
The lung houses structures of both the conducting and respiratory zones.
The left lung consists of three lobes.
The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters
Explanation:
Which two key stellar properties determine all
the other stellar properties?
Answer:
way of seeling and product that he/ she is seeling
Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary
Answer:
D. Weight varies with location, but mass does not vary
Explanation:
Weight can be defined as the force acting on a body or an object as a result of gravity.
Mathematically, the weight of an object is given by the formula;
[tex] Weight = mg [/tex]
Where;
m is the mass of the object.g is the acceleration due to gravity.Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.
Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).
Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.
why are earth and moon roughly the same age as the rest of the solar system ?
Answer:
Our solar system and everything in it was created at roughly the same time.
Explanation:
The Big Bang theory
The Moon is about 4.51 billion years old – significantly older than previously thought. Previous studies had suggested that it formed about 150 million years after the solar system.
Why is there no change in the moon's surface for billions of years?Eventually, erosion can break a crater down to virtually nothing. The Moon has almost no erosion because it has no atmosphere. That means it has no wind, it has no weather, and it certainly has no plants. Almost nothing can remove marks on its surface once they are made.
How was the Earth and moon formed?The Earth formed over 4.6 billion years ago out of a mixture of dust and gas around the young sun. It grew larger thanks to countless collisions between dust particles, asteroids, and other growing planets, including one last giant impact that threw enough rock, gas, and dust into space to form the moon.
Learn more about solar system here
https://brainly.com/question/1286910
#SPJ2
please help me with this
1. Indicate patient history details that are consistent with the patient having an infection. How do the patient’s signs and symptoms compare to a healthy individual?
2. Indicate what you suspect might be the etiological agent. What additional history would you like to have?
3. Based on the microbe you suspect is responsible for the symptoms, from which body sites would you recommend taking culture?
4. . Give culture and test characteristics of the microbe you suspect might be causing the disease. If you suspect more than one might be responsible, how might you distinguish the two?
5. Indicate virulence factors possessed by this microbe that might be responsible for the symptoms. Indicate how it produces the symptoms you observe in the patient.
6. Is this microbe normal microbiota at the culture site?
7. What type of treatment would be used for this patient
Answer:
All the answers are there in the photo
an example of is a leaking gasoline. tank
Answer:
When this happens, gas may leak from the vehicle, having an effect on fuel economy, and potentially leading to a dangerous fire or explosion. If gasoline is leaking from the gas tank, you should be able to notice the leak underneath the rear of the vehicle accompanied by a noticeable smell.So that obviously has tank or cylinder is a leaking gasoline.
Explanation:
mark me as brainliest if it helped you >•<
plants such as the venus flytrap produce chemical compounds that break down insects into substances that are usable by the plant
Answer:
The chemical compounds that break down the insects are most likely BIOLOGICAL CATALYSTS. Venus Flytrap is a kind of carnivorous plant.9
hope it helps
Name the main hormone that causes the tropic response movement of pollen tubes towards ovule.
Answer:
Chemotropism
Explanation:
Is there anything we as a society can do to prevent these pandemic from occurring
The only thing you can do now is to try do the necessary pre-causion, which are;
Always wear maskAlways be sanitizedAlways wear hand glovesKeep social distancingALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution
Answer:
the answer is C. Marine protection, research and sanctuaries Act.
Select the correct statement Question 65 options: 1) GPP is the energy spent staying alive 2) GPP is the energy used in cellular respiration 3) GPP is part of NPP 4) NPP is the energy used in growth and reproduction
Answer:
1) GPP is the energy spent staying alive
Explanation:
Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.
During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:
a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over
Answer:
Hi, there your answer is D.Crossing Over
Hope This Helps
PLZ CORRECT ME IF I AM WRONG :)
Explanation:
During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *
erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits
Answer:
1) erodes
2)deposits
Explanation:
How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?
Answer:
Due to presence on opposite side of the globe.
Explanation:
My model support the claim that the Northern and Southern Hemispheres have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.