Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Answers

Answer 1

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATGStop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´


Related Questions

1. What features are located medial to the cranium and the mandible. Identify the category here.
2. How many individual items are included in this category?

Answers

The features that are located medial to the cranium and the mandible are:teeth,tongue, lips, chick hard andsoft palate,

   2. There is a total of six individual items in this category.

The human skull is made up of two parts, the cranium, which contains the face and the brain and the only movable bone called the mandible or lower jaw.

The features that are medial to the cranium and the mandible are those structures that are nearer to the mid-line.

The above mentioned features works together to provide the following functions of the cranium:

protection of the delicate structures including the brain, eye and the inner ear.maintaining patency of the nasal passage enabling breathing.the movement of the mandible allows chewing.

Learn more here:

https://brainly.com/question/20273756

.

What is added to tacos, burritos, and soups that is
high in fiber?

Answers

Answer: flax seed whole wheat tortillas.

1⁄2 cup low-fat refried beans.

1⁄4 cup low-fat cheddar cheese.

leaves lettuce.

1⁄ cup salsa.

1⁄4 cup fat free sour cream.

Pinto beans are added to tacos, burritos, and soups that are high in fiber.

What are fibers and their types?

The body is unable to digest fiber, which is a form of carbohydrate. While fiber cannot be converted into glucose, the sugar that results from the breakdown of most carbs, fiber travels through the body undigested.

The solubility, viscosity, and fermentability of dietary fibers, which have an impact on how they are metabolized by the body, can be used to classify them in general. Dietary fibers have a wide range of chemical compositions.

Fibre comes in two varieties: soluble and insoluble. Both are crucial for good health, digestion, and illness prevention. Thus, Pinto beans are added to tacos, burritos, and soups that are high in fiber.

Learn more about fibers, here:

https://brainly.com/question/13805719

#SPJ6

2. The process of obtaining and using energy is called
metabolism
O photosynthesis
reproduction
homeostasis

Answers

Answer:

metaboliam is the ans of this question

Reviewing video surveillance is part of which alert food defense

Answers

Answer:

The correct answer is - look.

Explanation:

Alert is an acronym that is used in food defense that stands for Assure, Look, Employees, Reports, and Threat. It helps in increasing the awareness of food safety in food industries.

The Look is the type of alert that includes video surveillance in the food industry or store to check and maintain food safety and security. It helps in looking during and after the food defense.

The accurate solution is =look for is part of which alert food defense.

Alert is an acronym this is utilized in meals protection that stands for Assure, Look, Employees, Reports, and Threat. It facilitates in growing the attention of meals protection in meals industries.

The Look is the sort of alert that consists of video surveillance withinside the meals enterprise or shop to test and keep meals protection and security. It facilitates in searching in the course of and after the meals protection.

What is food defense?

Food protection is the safety of meals merchandise from infection or adulteration supposed to reason public fitness damage or financial disruption.

Thus it is well expailned.

To learn more about the  food defense refer to link :

https://brainly.com/question/20543853

What transmission pattern would indicate that a trait may be transmitted through X-linked inheritance

Answers

Answer:

The transfer pattern of an X-linked inheritance can be either X-linked dominant or X-linked recessive.

Explanation:

X-linked inheritance is the term that refers to a gene capable of causing a specific characteristic or disorder and is located on the X chromosome. During the transmission of genetic material for the formation of another living being, this gene can be transmitted through the transmission standards known as X-linked dominant or X-linked recessive.

X-linked dominance inheritance occurs when the dominant gene is transmitted on the X chromosome, while X-linked recessive inheritance occurs when the recessive gene is carried on the X chromosome.

Provide details about Meiosis.

Answers

Explanation:

a type of cell division that results in four daughters cells each with half the numbers of chromosomes of the parent cell , as in the production of gametes and plant spores

how does hair appear on the head​

Answers

Explanation:

Blood from the blood vessels in your scalp feeds the root, which creates more cells and makes the hair grow. The hair gets pushed up through the skin as it grows, passing an oil gland along the way.

Answer:

Hair grows by forming new cells at the base of the root. These cells multiply to form a rod of tissue in the skin. The rods of cells move upward through the skin as new cells form beneath them. As they move up, they're cut off from their supply of nourishment and start to form a hard protein called keratin.

Whic type of graph would you use if you wanted to see if one variable had an affect on another variable?

Answers

A scatter plot or scattergram chart will show the relationship between two different variables or it can reveal the distribution trends. It should be used when there are many different data points, and you want to highlight similarities in the data set.

Answer:

line

Explanation:

A line graph is used to see if there is a relationship between variables.

my voice for safety advocacy in text ride or driver​

Answers

Answer:

I cannot help you with that because there is no question

Predict what will happen to the concentration of pyruvate, NADH and H+ when the Krebs cycle is stopped by arsenic

Answers

Answer: Pyruvate would increase, NADH would decrease, and intermembrane H+ would decrease as well.

Explanation:

Glycolysis would raise pyruvate, but the Krebs Cycle would not produce NADH, decreasing it. No protons (H+) will be pushed into the intermembrane gap, lowering its H+ content and raising its pH.

What is Kreb's cycle?

The tricarboxylic acid (TCA) cycle, commonly referred to as the Krebs cycle or the citric acid cycle, is the primary route that cells use in order to acquire energy and is an essential component of aerobic respiration. The cycle transforms the oxidative potential of acetyl coenzyme A (acetyl CoA) into the reductive potential of nicotinamide adenine dinucleotide (NADH).

The synthesis of ATP via the Krebs cycle is disrupted when arsenic is present because it prevents pyruvate from being converted into acetyl coenzyme A (acetyl-CoA). In addition to the effects described above, arsenic also prevents glucose uptake at the cellular level, as well as gluconeogenesis, the oxidation of fatty acids, and additional acetyl-CoA formation.

Learn more about Kreb's cycle, here:

https://brainly.com/question/13153590

#SPJ2

How are meiosis and mitosis similar?



A.They both produce diploids.

B.They happen at the same time.

C.They both produce sex cells.

D.They both produce new cells.

Answers

Answer:

D.They both produce new cells.

Explanation:

Meiosis and mitosis are both processes of cell division; however, they have many differences. Meiosis occurs in sex cells and produces haploids that can be fertilized. Mitosis occurs in body cells and produces diploids that replace old or damaged cells. Still, both processes result in the creation of new cells.

Answer:

D) They both produce new cells!

Explanation:

Dont forget to give a thank you, and to rate my answer!

Short-term mechanisms for regulating blood pressure include regulating peripheral vascular resistance and cardiac output through:________-

Answers

Answer:

Dilation or constriction

Explanation:

Short-Term mechanism for regulating blood pressure include regulating peripheral vascular resistance and cardiac output through dilation or constriction of the blood vessels while on the other hand, long-term mechanism for controlling of blood pressure done by the renin-angiotensin system. Brains stem is the part of the brain that is responsible for the controlling of blood pressure in the body.

In which process do producers use chemi-
cal energy and make food?
A chemosynthesis
B fermentation
C glycolysis
D photosynthesis

Answers

Answer: D, Photosynthesis

Explanation:

photosynthesis is the process plants use to make food :)

5. The major functions of carbohydrates irſclude
A. Structure framework. B. Storage C. Both Aan B
D . None of these​

Answers

Answer:

D

Explanation:

used to provide energy to the body

Would an observational study or an experiment be more appropriate to investigate the effects on fertilizer on plant growth? Explain.

Answers

Answer:

Experiment

Explanation:

For such an investigation an Experiment would be the better option. This is because in an experiment you would have both an experimental group and a control group. This would allow you to use fertilizer on one but not the other, therefore, providing seperate results that you can use to compare with one another. This ultimately helps you determine the actual effects that fertilizer has on the growth of plants, since the fertilizer would be the only variable in the experiment. An observational study would only allow you to observe the plants in a natural scenario, without interfering and seperating the plants into different groups with different environments.

Vasopressin works on

Answers

Answer:

To treat diabetes insipidus, which is caused by a lack of this naturally occurring pituitary hormone in the body. And used to treat or prevent certain conditions of the stomach after surgery or during abdominal x-rays.

are oxygen and glucose products in cellular respiration?

Answers

Answer:

no the oxygen and glucose are used to produce ATP in cellular respiration

What are the products of photosynthesis?

Answers

Answer:

option C

Explanation:

Glucose and oxygen

In pea plants, flowers are either white or purple: the purple color is produced by pigments called anthocyanins. The production of anthocyanins is a two-step process: the first step is controlled by the C gene and the second by the P gene. Both genes must produce functional proteins for anthocyanin to be produced. This is an example of:

Answers

Answer:

This is an example of gene translation.

Explanation:

Gene translation refers to the genetic process where a set of genes is used to create amino acids that will be responsible for creating a protein needed to perform some function or characteristic of the organism. In the question above, we can see that anthocyanin, responsible for the pigment of flowers, is created through the work of proteins that are created from gebes C and P. This is an example of gene translation, as it presents the formation of proteins regulated by genes.

elaborate the value of wildlife

Answers

Answer:

1.Comm ercial Value- money made from wildlife and fish.

2.G ame Value- Value of wildlife as g ame.

3.Aesthetic Value- Value of wildlife for it's b b eauty and ple asure.

4.Scientific Value- Value placed on the study and res earch of wildlife.

5.they provides us food , clothing and source of income 

hope this will help you more..

How will you isolate DNA from a pure fungal culture

Answers

Answer:

Explanation:

There are several ways of isolating DNA from a pure fungal culture but you can use the CTAB method.

In this method, genomic DNA can be extracted.

First of all, the cell walls of fungal mycelia can first be broken down by grinding it using glass rods or you can use or liquid nitrogen. Place it in a plate. You can now CTAB extraction buffer , then incubate at 65°C, then let it undergo purification with phenol:chloroform:isoamyl alcohol 25: 24: 1 and carry out precipitation with isopropanol . Then the DNA can be extracted and then dissolved in 50 μl of pure water.

Question 8 of 30
Which of these fields of study would be the most useful for someone
interested in preserving native plants in grasslands?
A. Meteorology
B. Botany
C. Chemistry
D. Anthropology
SUBMIT

Answers

Answer:

botany

Explanation:

since it deals with the study of plants

A solid reactant is placed into a beaker of a warm water. The liquid vigorously bubbles as the solid dissolves into the solution. What will most likely happen if the temperature of the liquid is slightly reduced?
More bubbles will be produced because the solution is becoming more concentrated.
Fewer bubbles will be produced because of fewer collisions of reactant molecules.
The solid will get smaller at a faster rate because of more collisions of reactant molecules.
The solid will get larger at a slower rate because precipitate is coming out of the solution.

Answers

Answer: Fewer bubbles will be produced because of fewer collisions of reactant molecules.

Answer:

B: Fewer bubbles will be produced because of fewer collisions of reactant molecules.

Question 2 of 26
What happens at a subduction zone between an oceanic plate and a
continental plate?
O A. The continental plate slides under the oceanic plate, and
part of it melts to form magma that sinks into the mantle.
O B. The oceanic plate and continental plate pull away from
each other, allowing magma to rise and form an ocean
ridge.
O c. The oceanic plate and continental plate slide past each
other, creating a series of faults that allow magma to rise
and form a chain of volcanoes.
O D. The oceanic plate slides under the continental plate, and
part of it melts to form magma that rises up through the
continental plate.
SUBMIT

Answers

D. The oceanic plate is more dense and will slide under the continental one

The skin is protected by the action of cells that arise from bone marrow and migrate to the epidermis. Which cells serve this function?

Answers

Answer:

Langerhan's cells

Explanation:

The Langerhan's cells arise from the bone marrow and migrate to the epidermis. The Langerhan's cells are the body's first line of defense and play a significant role in antigen presentation. They need special stains to be visualized and are primarily found in the stratum spinosum. These are the mesenchymal origin obtained from CD34 positive stem cells of bone marrow and are part of the mononuclear phagocytic system.

What trait are narcissists likely to have that is associated with leader emergence but not effectiveness

Answers

Answer:

Agreeableness.

Explanation:

Agreeableness is the trait that narcissists likely to have which is negatively corelated and is associated with leader emergence but not effectiveness. The tendency toward self-interest would attract the person into follow his or her own goals rather than the interests of their group or company. The term Narcissism originated from Greek mythology, where a young man whose name is Narcissus fell in love with his own image reflected in a pool of water so that's why selfness and self interests refers to Narcissism.

why are electrons in an atom involved in bonding

Answers

Answer:

The valence electrons have a role in the bonding of two atoms. The nuclei of each atom are drawn together by their attraction to the valence electrons of the other atom. As the atoms are drawn together by their attractions, electrons from each atom are drawn to the nuclei of both atoms, where they are "shared."

OAmalOHopeO

explain the importance of taking named precautions before blood transfussion can be done?​

Answers

Answer:

To minimize the chance of an adverse reaction during a transfusion, health care practitioners take several precautions. Before starting the transfusion, usually a few hours or even a few days beforehand, the person is cross-matched with the donor blood (not done for transfusions of plasma or platelets).

Precautions are necessary for blood transfusion because
There are chances of getting exposed to fatal diseases like hepatitis, AIDS and many other diseases.
And avoid the reactions between antigen and antibodies, which leads to rejection of transfused blood.

Good luck

Regards
BLACKSHARK

3. The DNA double helix is stabilized by hydrogen bonds between:

Answers

Answer:

Between Dioxide and Ribonuse Acid

Explanation:

hope it helps

Answer:

The structure of the DNA helix is stabilized by van der Waals forces, hydrogen bonds between complementary organic bases (a base pair), and hydrophobic interactions between the nitrogenous bases and the surrounding sheath of water

Which of the following is a benefit of dams?

A. They impede fish migration and spawning

B. They provide a source of energy

C. They increase the sediment load of waterways


D. They divert water from ecosystems

Answers

A. They impede fish migration and spawning
Other Questions
TotalWinnings0Translate You are going to study into Spanish in the box below:The car is far away from the park What is language called when it creates or reinforces stereotypes, treatspeople unequally, insults people, excludes people, and can accentuatepersonal attributes in exclusion of other more important attributes?A. IllegalB. InclusiveC. DiscriminatoryD. DeclamatoryHelp How would A = L + O be rewritten to solve for O? Identify the type of equation: y-6 = 7(x+8) 5. a. Answer the following questions. What is density? Write a formula by showing the relation among density mass and volume. Chn dng ng ca ng t trong ngoc Many people like to be _ and rich (fame) Question 5 10 pts Which function represents the inverse of f(x) = (x + 6)2 - 5? of 1(1) = V1 + 5 - 6 of '(x) = (x + 5)2 - 6 of '(x) = V1 6 + 5 Of '(x) = (x + 6 5 A specimane collection helps a scientsist do research by:A. Asembling a large number of sample comparisons B.providing a way to afford even the most expensive equpmentC.creating a realistic depiction of an imaginary undersea worldD.summerizing the results of an other scientists investigations What efforts have been made in Nepal to produce skilled human resourcefor the economic and social development of the country? C4H9OH have several isomers. Draw structure and IUPAC names of its three isomers. Write a balanced half-reaction for the oxidation of manganese ion (mn2 ) to solid manganese dioxide (mno2) in acidic aqueous solution. Be sure to add physical state symbols where appropriate. Differentiate between GDP and GNP in a sentence. Rectangle KLMN has vertices K(-5,6), L(-2,9), M(6, 1), and N(3,-2). Determine and state the coordinates of the point of intersection of the diagonals. what are some different jobs in the legal profession? The turbines in a hydroelectric plant are fed by water falling from a 50 m height. Assuming 91% efficiency for conversion of potential to electrical endrgy, and 8% loss of the resulting power in transmission, what is the mass flow rate of water required to power a 200 W light bulb? A 1.5kg block slides along a frictionless surface at 1.3m/s . A second block, sliding at a faster 4.3m/s , collides with the first from behind and sticks to it. The final velocity of the combined blocks is 2.0m/s . What was the mass of the second block? Indicate in standard form the equation of the line through the given points, writing the answer in the equation box below. K(6, 4), L(-6, 4) 1. A year has twelve months There are..................................................................................................................... compared to an atom of C-14, an atom of C-12 has a lesser atomic numbernumber of protonsnumber of electronsnumber of neutrons How does satire create meaning in this cartoon?