Giving brainliest!!!! Plzz put the correct answers.
2^(10)= 2x...x2 how many times
15^(57)= 15x...x15 how many times
(-4)x...x(-4) 7 times =
(1.5)x...x(1.5) 12 times =
If you give me the answer after like an hour i willl report you!!

Answers

Answer 1

Answer:

See below

Step-by-step explanation:

aⁿ = a×a×a×....×a  (power n of the number a  =  number a multiplied by itself n times)

2^(10)= 2x...x2 how many times  =  10 times 2

15^(57)= 15x...x15 how many times  = 57 times 15

(-4)x...x(-4) 7 times =  (-4)^(7)

(1.5)x...x(1.5) 12 times = (1.5)^(12)


Related Questions

The average weight of the top 5 fish caught at a fishing tournament was 12.3 pounds. Some of the weights of the fish are shown in the table.

What was the weight of the heaviest fish?

Answers

Answer:

14.6

Step-by-step explanation:

It is given that,

The average weight of the top 5 fish caught at a fishing tournament was 12.3 pounds. From the attached figure, the weight of 5 fish are given. We need to find the weight of Wayne S. fish.

Average = sum of terms/no of terms

Let the weight of Wayne S. is x. So,

Here the sum of terms is x+12.8+12.6+11.8+9.7 and the number of terms is 5.

[tex]12.3=\dfrac{x+12.8+12.6+11.8+9.7}{5}\\\\61.5=x+12.8+12.6+11.8+9.7\\\\61.5=x+46.9\\\\x=14.6[/tex]

So, the weight of the heaviest fish is 14.6.

5. The volleyball team has a double-header on Friday. The probability that they
will win both games is 38%. The probability that they will win just the first game is
70%, What is the probability that the team will win the second game given that
they have already won the first game?

Answers

Answer: 54.29%

Step-by-step explanation:

Given: The probability that they  will win both games is 38%.

i.e. P( both games will win) =0.38

The probability that they will win just the first game is  70%.

P(first game will win) = 0.70

To find : P(second game will win| first game will win)

Using formula: [tex]P(B|A)=\dfrac{P(\text{both A and B})}{P(A)}[/tex]

So, P(second game will win| first game will win) = [tex]\dfrac{\text{ P( both games will win)}}{\text{P(first game will win)}}[/tex]

[tex]=\frac{0.38}{0.70}\approx0.5429=54.29\%[/tex]

Hence, the required probability = 54.29%



Kite WXYZ is graphed on a coordinate plane.
What is the area of the kite ?

Answers

the area of the kite is 44.6 -

Answer: 14 units^2

Step-by-step explanation: 2 times 3 is 6, 2 times 4 is 8, 6+8=14.

2. The ratio of
the profit, cost of
materials and labour
in the production of
an article is 5:7:13
respectively. If the
cost of materials is Le
840 more than that of
labour, find the total
cost of producing the
article​

Answers

Answer:

3500

Step-by-step explanation:

Given the  ratio of  the profit, cost of  materials and labour  in the production of

an article to be 5:7:13 respectively, total ratio = 5+7+13 = 25

If the cost of labour is x, the cost of material will be 840+x (since the  cost of materials is Le  840 more than that of  labour)  .

Let the total cost of producing the article be y.

Cost of labour = 13/25 * y = x

Cost of labour  = 13y/25 = x.................... 1

Cost of material = 7/25*y = 840+x

Cost of material = 7y/25 = 840+x ..................... 2

From 1, 13y = 25x

x = 13y/25 ................... 3

Substituting equation 3 into 2:

7y/25 = 840+x

7y/25 = 840+13y/25

collect the like terms:

7y/25 - 13y/25 = 840

-6y/25 = 840

-6y = 25*840

y = 25*840/6

y = 3,500

Hence the total cost of producing the article is 3500

What x value solves the equation? 3x – 5 = 1 x =

Answers

Answer:

x = 2

Step-by-step explanation:

3x - 5 = 1

Adding 5 to both sides gives us:

3x - 5 + 5 = 1 + 5

3x = 6

Dividing the equation by 3 gives us:

3x / 3 = 6 / 3

x = 2

Answer:

x = 2 Hfizfifsits96eotst9s

How do I do this? All of em

Answers

Answer:

Hey there!

The equation of all of these problems should be in slope-intercept, or, y=mx+b form.

In y=mx+b form, the m is the gradient, and y intercept is the b value.

a) y=2x+4

b) y=-2x-4

c) y=1x-1/5 (But as you may know, 1x=x, because one times any number is just that number, so we can actually have: y=x-1/5.)

d) y=-x+3.78

e) y=-2/3x+0 (Can be simplified to y=-2/3x)

f) y=0x-2/3 (Can be simplified to y=-2/3)

This can be confusing, especially if you're new to the topic. Let me know if you need more help :)

Can you help Jorge organize the results into a two-way frequency table?

Answers

Answer:

See Explanation

Step-by-step explanation:

Given

Students = 24

Musical Instrument and Sport = 6

Neither = 3

Sport = 14

Required

Complete the two-way frequency table

-------------------------------------------------------- Plays sport || Does not play sport

Plays a musical instrument ---------------------6--------------------------------------

Does not play a musical instrument -------------------------------------3-----------

Total ---------------------------------------------------- 14 ---------------------------------------

To solve this, we'll make use of the following naming rules

A represent students that plays musical instrument; A = 6

B represent students that do not play musical instrument

C represent students that plays sport

D represent students that do not play sport; D = 3

Considering the first column [Plays a sport] and taking note of the naming rules;

[tex]A + B = 14[/tex]

Substitute 6 for A

[tex]6 + B = 14[/tex]

Solve for B

[tex]B = 14 - 6[/tex]

[tex]B = 8[/tex]

Also, given that there are 24 students in the class and 14 of them play sport; this implies that 10 do not play sport

Considering the second column [Does not play a sport]

[tex]C + D = 10[/tex]

Substitute 3 for D

[tex]C + 3 = 10[/tex]

Solve for C

[tex]C = 10 - 3[/tex]

[tex]C = 7[/tex]

Hence, the complete table is:

-------------------------------------------------------- Plays sport || Does not play sport

Plays a musical instrument ---------------------6--------------------------7----------

Does not play a musical instrument ---------8--------------------------3---------

Total ---------------------------------------------------- 14 -----------------------10---------

I am thinking of 3 consecutive numbers. The first is a multiple of 4, the second is a multiple of 5 and the third is a multiple of 6." What could the numbers be? Can you find 3 possible sets of numbers

Answers

Answer:

{4, 5, 6}, {64, 65, 66}, {124, 125, 126}

Step-by-step explanation:

x = 1st number

x + 1 = 2nd number

x + 2 = 3rd number

{4, 5, 6}, {64, 65, 66}, {124, 125, 126}

The possible set of numbers are {4,5,6}, {64,65,66} and {124,125,126}

What are consecutive number?

Consecutive numbers are the numbers which follow each other in order from small to greater number.

Let three consecutive numbers are, x ,x+1 and x+2.

According to given condition,

The first number is a multiple of 4,

The second number is a multiple of 5,

And The second number is a multiple of 6.

Start from 4 and then try to find out sequence,

The numbers can be 4, 5 and 6.

Further, the number can be 64,65 and66

And The numbers can be 124,125 and 126

So, three sets of numbers are {4,5,6}, {64,65,66} and {124,125,126}

To know more about Consecutive number on:

https://brainly.com/question/2493629

#SPJ5

24.
What is the slope of a line through (-3, 4) and
(5, 6)?

PLEASE help if you can!!​

Answers

Answer:

slope = 2 : 8 or 1:4

Step-by-step explanation:

a(-3, 4)

b(5, 6)

slope = rise / run

slope (6-4, 3+5))

slope = 2 : 8 or 1:4

Answer:

Slope =¼

Step-by-step explanation:

[tex](-3, 4) \: (5, 6) \\ x _{1} = - 3 , y_1 = 4 \\ x_2 = 5 \\ y_2 = 6[/tex]

[tex]m = \frac{y_2 - y_1}{x_2 - x_1} \\ m = \frac{6 - 4}{5 - ( - 3)} \\ m = \frac{2}{8} = \frac{1}{4} [/tex]

When a fish is selected at random from a tank, the probability that it has a green tail is 0.36, the probability that it has red fins is 0.59, and the probability that it has both a green tail and red fins is 0.21. What is the probability that the selected fish will not have a red fin or a green tail?

Answers

Answer: 0.26

Step-by-step explanation:

As per given , we have

P(green tail) = 0.36

P(red fins) = 0.59

P(both a green tail and red fins ) = 0.21

Now, P(Neither red fin nor green tail )= 1 - P(either red fin or green tail )

[P(neither A nor B)= 1- P(either A or B)]

= 1-(P(green tail) +P(red fins)+P(both a green tail and red fins ))

[P(A or B)= P(A)+P(B)-P(A and B)]

= 1- (0.36+0.59-0.21)

= 1-(0.74)

= 0.26

Hence, the probability that the selected fish will not have a red fin or a green tail = 0.26

There were 96 people in a queue to get into a fun fair. There were at least
4 children between any 2 adults.
What was the largest possible number of adults in the queue?​

Answers

Answer:

32 adulta

Step-by-step explanation:

96÷6 = 16 number of families

now we need to see how many adults there are in 16 families.

and the number is 32 adults.

Answer:

32 adults.

Step-by-step explanation:

At the very least, there are 4 children for every 2 adults. That means that, at the very least, there are 6 people in one group to get into the fun fair.

96 / 6 = 16

So, there are 16 groups trying to get into the fun fair, with 2 adults in each group. 2 * 16 = 32 adults are in the queue.

Hope this helps!

two similar cups are 3 cm and 5 cm deep if the larger cup
s hold 675 cm cube of water what is the volume of the smaller one​

Answers

Answer:

145.8

Step-by-step explanation:

l.s.f for the two is 3:5

volume scale factor will be 3³:5³ which us 27:125

so 27×675 / 125

= 145.8

Which number is closest to O on the number line?
-0.26
0.3
0.275
-0.51

Answers

Answer:

-.26

Step-by-step explanation:

If you take the absolute value (indicates how far a number-negative/positive- is from 0) of each number u listed you will find that .26 is the smallest number,thus smallest number.

Answer:

-.26 is closest to 0 on the number line.

Step-by-step explanation:

To find distance we use absolute value to find the smallest absolute value.

The absolute value of each number is as follows

-0.26 (0.26)

0.3 (0.3)

0.275 (0.275)

-0.51 (0.51)

In order from least to greatest we have

.26, .275, .3, .51

Therefore -.26 is closest to 0 on the number line.

Good luck!!

plz help me asap!!!!!
What is the equation of the linear function represented by the table?

x
y
–5
14
–2
11
1
8
4
5
y = negative x + 9
y = negative x + 13
y = x + 13
y = x + 9

Answers

Answer:

It would be y = -x + 9

Step-by-step explanation:

Answer:

Y=-x+9

Step-by-step explanation:

Find an equation for the nth term of the arithmetic sequence. 9, 11, 13, 15, ...

Answers

Answer:

2n+7

Step-by-step explanation:

First lets find the common difference which is 2, now we can use this formula to find the nth term.

an = a1 + (n - 1 ) d

an= 9+(n-1)2

=9+2n-2

=2n+7

To check let's insert n=5, 2(5)=10+7=17.

15+2=17!

A researcher obtained M = 27 for a sample of n = 36 scores selected from a population with µ = 30 and σ = 18. This sample mean corresponds to a z-score of z = –1.00.

Answers

Answer:

True

Step-by-step explanation:

Given that:

M = 27, sample of n = 36 scores, µ = 30 and σ = 18.

The z score is used in statistics to determine by how many standard deviations the raw score is above or below the mean. If the z score is positive, the raw score is greater than the mean and if the z score is negative the raw score is less than the mean. The z score is given as:

[tex]z=\frac{x-\mu}{\sigma}[/tex]

Given that M = 27, this means that x = 27. Therefore:

[tex]z=\frac{x-\mu}{\sigma}\\\\for \ a\ sample\ size(n):z=\frac{x-\mu}{\sigma/\sqrt{n} }\\\\z=\frac{27-30}{18/\sqrt{36} } =\frac{-3}{3}=-1[/tex]

This sample mean corresponds to a z-score of z = –1.00.

PLEASE ANSWER QUICKLY ASAP
ANSWER QUESTION A AND B​

Answers

Answer:

a) [tex]a+b+c=\begin{pmatrix}-2\\-3\end{pmatrix}[/tex]

b) (i) [tex]a+2c=\begin{pmatrix}-4\\2\end{pmatrix}[/tex]

   (ii) [tex]k=2[/tex]

Step-by-step explanation:

It is given that,

[tex]a=\begin{pmatrix}4\\-10\end{pmatrix},b=\begin{pmatrix}-2\\1\end{pmatrix},c=\begin{pmatrix}-4\\6\end{pmatrix}[/tex]

a)

We need to find the value of a+b+c.

[tex]a+b+c=\begin{pmatrix}4\\-10\end{pmatrix}+\begin{pmatrix}-2\\1\end{pmatrix}+\begin{pmatrix}-4\\6\end{pmatrix}[/tex]

[tex]a+b+c=\begin{pmatrix}4+(-2)+(-4)\\-10+1+6\end{pmatrix}[/tex]

[tex]a+b+c=\begin{pmatrix}-2\\-3\end{pmatrix}[/tex]

b)

(i) We need to find the value of a+2c.

[tex]a+2c=\begin{pmatrix}4\\-10\end{pmatrix}+2\begin{pmatrix}-4\\6\end{pmatrix}[/tex]

[tex]a+2c=\begin{pmatrix}4\\-10\end{pmatrix}+\begin{pmatrix}-8\\12\end{pmatrix}[/tex]

[tex]a+2c=\begin{pmatrix}4+(-8)\\-10+12\end{pmatrix}[/tex]

[tex]a+2c=\begin{pmatrix}-4\\2\end{pmatrix}[/tex]

(ii) It is given that a+2c=kb, where k is an integer. We need to find the value of k.

[tex]a+2c=k\begin{pmatrix}-2\\1\end{pmatrix}[/tex]

[tex]\begin{pmatrix}-4\\2\end{pmatrix}=\begin{pmatrix}-2k\\k\end{pmatrix}[/tex]

On comparing both sides, we get

[tex]k=2[/tex]

The size of a television screen is given as 95 cm, correct to the nearest 5 cm.
Write down the upper bound of the size of the television screen.

Answers

Answer:

U B = 100.5

Step-by-step explanation:

the upper bound of the size of the television screen= 95.5 since it is corrected to the nearest 5 then the U B =100.5 cm

The upper bound of the size of the television screen is 100.5 cm

The conversion of the size of the television screen to the nearest 5cm from the initial size of 95 cm is = 100 cm.

Now, the upper bound of the size of the television screen which is 100 is can be determined by the addition of a half value to 100 cm:

i.e.

= (1/2) + 100 cm

= 0.5 + 100 cm

= 100.5 cm

Therefore, we can conclude that the upper bound of the size of the television screen is 100.5 cm

Learn more about nearest value here:

https://brainly.com/question/16382026?referrer=searchResults

PLZ HELP MEH:(



Mean, Median, and Mode
quenage
Find the mean, median, mode and range for each set of data.
1. 6. 9, 2, 4, 3, 6,5

2. 25, 18, 14, 27, 25, 14, 18, 25, 23

3. 453, 345, 543, 345, 534

4. 13, 6, 7, 13,6

5. 8, 2,9, 4, 6, 8,5

6. 13, 7, 17, 19, 7, 15, 11, 7

7. 1, 15, 9, 12, 18, 9, 5, 14, 7

8. 28, 32, 23, 43, 32, 27, 21, 34

9. 3,9, 4, 3, 9, 4, 2, 3, 8

10. 42, 35, 27, 42, 38, 35, 29, 24

11. 157, 124, 157, 124, 157, 139



Answers

Answer:

to find the mean add all numbers the divide by the ammount of numbers given

Step-by-step explanation:

ex: 1 , 2 , 3    

add:

1+2+3=6

divide:

6 / 3 = 2  

your mean is 2

all good?

Answer: to find the mean add up all numbers and divide them by the amount of numbers there and to find the median that is the middle number write it on a piece of paper and cross out the beginning and end till you get the to the middle that is your median

Step-by-step explanation:

plz help ASAP! thank u

Answers

Answer: Choice B)

The relation is a function because there are no vertical lines that can be drawn on the graph that pass through more than one point.

This graph passes the vertical line test. Any input (x) leads to one and only one output (y). An example of a graph failing the vertical line test would be a graph that is a sideways parabola.

-4(2x-3) simplified

Answers

Answer:

-8x + 12

Step-by-step explanation:

Distribute -4 to the parentheses:

-4(2x - 3)

-4(2x) = -8x

-4(-3) = 12

-8x + 12

Answer:

-8x +12

Step-by-step explanation:

-4(2x-3)

Distribute

-4* 2x -4 *-3

-8x +12

The pregnancy length in days for a population of new mothers can be approximated by a normal distribution with a mean of days and a standard deviation of days. ​(a) What is the minimum pregnancy length that can be in the top ​% of pregnancy​ lengths? ​(b) What is the maximum pregnancy length that can be in the bottom ​% of pregnancy​ lengths? ​(a) The minimum pregnancy length is 280 days.

Answers

Answer:

(a) 283 days

(b) 248 days

Step-by-step explanation:

The complete question is:

The pregnancy length in days for a population of new mothers can be approximated by a normal distribution with a mean of 268 days and a standard deviation of 12 days. ​(a) What is the minimum pregnancy length that can be in the top 11​% of pregnancy​ lengths? ​(b) What is the maximum pregnancy length that can be in the bottom ​5% of pregnancy​ lengths?

Solution:

The random variable X can be defined as the pregnancy length in days.

Then, from the provided information [tex]X\sim N(\mu=268, \sigma^{2}=12^{2})[/tex].

(a)

The minimum pregnancy length that can be in the top 11​% of pregnancy​ lengths implies that:

P (X > x) = 0.11

⇒ P (Z > z) = 0.11

z = 1.23

Compute the value of x as follows:

[tex]z=\frac{x-\mu}{\sigma}\\\\1.23=\frac{x-268}{12}\\\\x=268+(12\times 1.23)\\\\x=282.76\\\\x\approx 283[/tex]

Thus, the minimum pregnancy length that can be in the top 11​% of pregnancy​ lengths is 283 days.

(b)

The maximum pregnancy length that can be in the bottom ​5% of pregnancy​ lengths implies that:

P (X < x) = 0.05

⇒ P (Z < z) = 0.05

z = -1.645

Compute the value of x as follows:

[tex]z=\frac{x-\mu}{\sigma}\\\\-1.645=\frac{x-268}{12}\\\\x=268-(12\times 1.645)\\\\x=248.26\\\\x\approx 248[/tex]

Thus, the maximum pregnancy length that can be in the bottom ​5% of pregnancy​ lengths is 248 days.

PLEASE help me with this question. This is really URGENT

Answers

Answer:

$6291.70

Step-by-step explanation:

You have the equation and a value to solve for. So, plug this in to get m = 2500 + 0.05(75,834) = 2500 + 3791.70 = $6291.70.

-3x+2y=6 Find the intercepts. Show your work.

Answers

Answer:

The x-intercept is (-2,0)

The y-intercept is (0,3)

Step-by-step explanation:

An x-intercept is the point when the graph crosses the x-axis. In other words, the y-coordinate of the x-intercept is 0 (since it lays on the x-axis). In other words, to solve for the x-intercept(s), plug in 0 for y and solve for x:

[tex]-3x+2y=6\\-3x+2(0)=6\\-3x=6\\x=-2[/tex]

So, the x-intercept is (-2,0).

Likewise, the y-intercept is the point when the graph crosses the y-axis. Because it's on the y-axis, the x-coordinate value would be 0. Thus, to find the y-intercept, plug in 0 for x and solve for y:

[tex]-3x+2y=6\\-3(0)+2y=6\\2y=6\\y=3[/tex]

Thus, the y-intercept is (0,3).

What is the justification for step 2 in the solution process? 12 − x = 7x + 32 Step 1: -x = 7x + 20 Step 2: -8x = 20
A. the division property of equality
B.the addition property of equality
C. the subtraction property of equality
D. the multiplication property of equality

Answers

Answer:

C. the subtraction property of equality

Step-by-step explanation:

given

12 − x = 7x + 32

Subtract 12 from each side  using the subtraction property of equality

Step 1: -x = 7x + 20

Subtract -7x from each side using the subtraction property of equality

Step 2: -8x = 20

6) 8x+y=-16
-3x+y=-5
Solve each system by elimination?

Answers

Answer:

x=-2.2 y=-1.6

Step-by-step explanation:

8x+y=-16

-3x+y=5

5x=-11

x=-11/5 or -2.2

-3x+y=5

-3(-2.2)+y=5

6.6+y=5

-6.6+y=-6.6

y=-1.6

Answer:

(−1, −8)

Step-by-step explanation:

(8x+y=−16)−1(−3x+y=−5)Becomes:8x+y=−163x−y=5Add these equations to eliminate y:11x=−11Then solve11x=−11for x:11x=−1111x11=−1111(Divide both sides by 11)x=−1

Now that we've found x let's plug it back in to solve for y.Write down an original equation:8x+y=−16Substitute−1forxin8x+y=−16:(8)(−1)+y=−16y−8=−16(Simplify both sides of the equation)y−8+8=−16+8(Add 8 to both sides)y=−8

Match each quadratic equation with its solution set.

Answers

Answer:

2x²-32 ⇒ x²=16⇒ (-4,4)

4x²-100 ⇒x²=25 ⇒(-5,5)

x²-55=9 ⇒x²=64 ⇒(-8,8)

x²-140=-19 ⇒x²=121 ⇒(-11,11)

2x²-18=0 ⇒x²=9 ⇒(-3,3)

Answer:

2x^2-32 = 0 ===> (-4,4)4x^2 -100=0 ===> (-5,5)x^2 -55=9 ==>(-8, 8)x^2-140= -19 ===>(-11 ,11)

Step-by-step explanation: Further explanation

[tex]2x^2-32=0\\\\\mathrm{Add\:}32\mathrm{\:to\:both\:sides}\\\\2x^2-32+32=0+32\\\\2x^2=32\\\\\frac{2x^2}{2}=\frac{32}{2}\\\\\mathrm{For\:}x^2=f\left(a\right)\\\\\mathrm{\:the\:solutions\:are\:}x=\sqrt{f\left(a\right)},\:\:-\sqrt{f\left(a\right)}\\\\x=\sqrt{16},\:x=-\sqrt{16}\\\\x=\sqrt{16},\:x=-\sqrt{16}\\x=4,\:x=-4[/tex]

[tex]4x^2-100=0\\\mathrm{Add\:}100\mathrm{\:to\:both\:sides}\\4x^2-100+100=0+100\\4x^2=100\\\frac{4x^2}{4}=\frac{100}{4}\\x^2=25\\\mathrm{For\:}x^2=f\left(a\right)\\\mathrm{\:the\:solutions\:are\:}x=\sqrt{f\left(a\right)},\:\:-\sqrt{f\left(a\right)}\\x=\sqrt{25},\:x=-\sqrt{25}\\\\x=5,\:x=-5[/tex]

[tex]x^2-140=-19\\x^2-140+140=-19+140\\x^2=121\\\mathrm{For\:}x^2=f\left(a\right)\\\mathrm{\:the\:solutions\:are\:}x=\sqrt{f\left(a\right)},\:\:-\sqrt{f\left(a\right)}\\x=\sqrt{121},\:x=-\sqrt{121}\\x=11,\:x=-11[/tex]

[tex]x^2-55=9\\x^2-55+55=9+55\\x^2=64\\\mathrm{For\:}x^2=f\left(a\right)\\\mathrm{\:the\:solutions\:are\:}x=\sqrt{f\left(a\right)},\:\:-\sqrt{f\left(a\right)}\\x=\sqrt{64},\:x=-\sqrt{64}\\x=8,\:x=-8\\[/tex]

[tex]2x^2-18=0\\2x^2-18+18=0+18\\2x^2=18\\\frac{2x^2}{2}=\frac{18}{2}\\x^2=9\\\mathrm{For\:}x^2=f\left(a\right)\\\mathrm{\:the\:solutions\:are\:}x=\sqrt{f\left(a\right)},\:\:-\sqrt{f\left(a\right)}\\x=\sqrt{9},\:x=-\sqrt{9}\\x=3,\:x=-3[/tex]

Points C and D are on a number line (not shown).

The coordinate of point C is -16 and the coordi-
nate of point D is 14. Point E is a point on line

segment CD. If the distance from point E to point C
is 1
4
the distance from point E to point D, what is
the coordinate of point E?



Answers

Answer:

17

Step-by-step explanation:

i’m pretty bad at math

Answers

Answer:

2m - 3

Step-by-step explanation:

We know that Jim ran m miles. Twice that amount is simply 2 times that, or 2 * m which simplifies to 2m. 3 miles fewer means that we have to subtract 3 from that quantity, so the answer is 2m - 3.

Answer:

2m - 3

Step-by-step explanation:

Distance ran by Jim = m

Twice as far as Jim : 2 * m = 2m

3 miles fewer than '2m' = 2m - 3

Distance ran by Kelly = 2m - 3

Please answer this in two minutes

Answers

Answer:

x = 16

Step-by-step explanation:

The figure shown shows an inscribed angle F and central angle E. Both angles intercept the same arc.

Therefore, angle E is twice the measure of angle F, according to the central angle theorem of a circle.

Thus,

m<E = 2 * m<F

(x + 94)° = 2(55)

We can find the value of x with this equation.

x + 94 = 110

Subtract 94 from both sides

x = 110 - 94

x = 16

Other Questions
The Coat of Arms includes two phrases, "Blessed are the peacemakers" and "Shame to him who evil thinks." Choose one of these phrases and explain why a ruler might want it included in a coat of arms A tour group is going sea diving. Sea level is O feet. The oceanfloor is -18 feet. One diver is already at -11 feet. The tour guideis keeping watch on the deck at 5 feet above sea level directlyabove the diver. What is the distance from the tour guide to thediver? Draw and label a number line to justify your answer. jawaban dari 5x 7 = 13 adalah....... dijawab ya.... An analyst takes a random sample of 25 firms in the telecommunications industry and constructs a confidence interval for the mean return for the prior year. Holding all else constant, if he increased the sample size to 30 firms, how are the standard error of the mean and the width of the confidence interval affected Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment? Investment in human capital is very similar to investing in physical capital. True or false? Explain your answer. Given money demand, by how much would the Moola central bank need to change the money supply to close the output gap? TRUE OR FALSE The Enlightenment in the American Revolution rejected traditional religious, political and social values. The ratio of sales to invested assets, which is also a factor in the DuPont formula for determining the rate of return on investment, is called Rearrange the tiles so that it shows the proper steps of solving this quadratic equation using square property Instruments had retained earnings of at December 31, . Net income for totaled , and dividends declared for were . How much retained earnings should report at December 31, ? show that the point p(-6,2), Q(1,7) and R(6,3) are the vertices of scalene triangle The work function of a certain metal is = 3.55 eV. Determine the minimum frequency of light f0 for which photoelectrons are emitted from the metal. (Planck's constant is: h = 4.135710-15 eVs.) These box plots show daily low temperatures for a sample of days in two different towns. Yo tengo once aos y no tengo hermanos. Mitiene cuarenta aos. l es grande y cmico.padremadrehermanohija Divide a 6 and 3/4 inch line into three parts so that each part is 1/4 inch shorter than the one before it. How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbaria or gardens.(Students may do research on internet to answer this question )plz correct answerbe quick either you will eat or you will be picked up what happens to the chromosomes if nondisjunction occurs during meiosis one versus meiosis two Find a linear inequality with the following solution set. Each grid line represents one unit.Pllzzzzzzz help!!!!!!!!!!