Helpppp. Pleaseee. Thankssss

Answers

Answer 1
What you need help with
Answer 2
Could you please inform what you need help with?

Related Questions

Which word has a syllable (word part) that is related to Greek mythology?
definitive
blockade
hydraulic
equality

Answers

Think it’s hydraulic
It’s Hydraulic:) your welcome

Identify tactics White southerners did to deprive freed southern Blacks of their civil rights?
Required proof of employment or face arrest
Made literacy a requirement for voting
Forced Blacks to rent land only within cities
All the above

Answers

Answer:

Its all of the above NOT C

Explanation:

I got it right on the exam.

One result of the War of 1812 was that the United

States

Answers

Answer: A

Explanation: The US maintained territory but not all of it, but they also gained territory from the French

Lali tells Gloria that she keeps receiving mean messages on her cellphone from a classmate. If Gloria wants to be an upstander or an ally, which of the following could she do? Check all that apply.

Empathize with Lali and ask her if she wants to talk about it.

Tell an adult about the messages Lali is receiving.

Feel embarrassed for Lali and not say anything.

Ask to see the messages and then laugh at them.

Talk to the classmate and tell him or her to stop sending mean messages.

Answers

Answer:

Tell an adult about the messages Lali is receiving.

Talk to the classmate and tell him or her to stop sending mean messages.

Empathize with Lali and ask her if she wants to talk about it.

Explanation:

:))))))))))))))))))))

PLZ HELP
What were the weaknesses of the national government under the Articles of Confederation?


no national legislature
no authority to deal with foreign governments
large states wanted more voting power than small states
no executive branch
no national court system
no power to levy taxes

Answers

Answer: No court, no authority, states wanted more power, no taxing, no executive branch, printed money, central gov was weak

Explanation: Under the AOC, there was no judicial branch (no court) or executive. They only have a unicameral legislature. The states wanted and had most of the power, making the central government weak, and they had no power to tax, and to make money, they printed it, but that caused inflation making it worthless.

What was the main reason that Athens and Sparta fought the Peloponnesian War?

A.
Sparta wanted to overthrow the Athenian oligarchy.
B.
Athens wanted to become the most powerful city-state in Greece.
C.
Sparta and its allies felt threatened by Athens’s growing power.
D.
Athens wanted to control the biggest navy in ancient Greece.

Answers

Sparta wanted to overthrow the Athenian oligarchy. Athens wanted to become the most powerful city-state in Greece. Sparta and its allies felt threatened by Athens's growing power.

Answer:

the answer is C) Sparta and its allies felt threatened by Athens's growing power.

Explanation: hope this helps

Name the colonies located in the Southern region and the year each colony was established.

Answers

Answer:

The southern colonies were made up of the colonies of Virginia, Maryland, North Carolina, South Carolina, and Georgia.

Maryland 1634

Connecticut c. 1635

Rhode Island 1636

Delaware 1638

Virginia 1607

Massachusetts 1620

1630 - Massachusetts Bay Colony

New Hampshire 1623

Delaware 1638

North Carolina 1653

South Carolina 1663

New Jersey 1664

New York 1664

Pennsylvania 1682

Georgia 1732

Do you mind brainlisting me? I need one more to rank. The NUMBER is the year established.

Are people racially profiled by the Police? why or why not, explain please

Answers

Racial Profiling" refers to the discriminatory practice by law enforcement officials of targeting individuals for suspicion of crime based on the individual's race, ethnicity, religion or national origin. Criminal profiling, generally, as practiced by police, is the reliance on a group of characteristics they believe to be associated with crime. Examples of racial profiling are the use of race to determine which drivers to stop for minor traffic violations (commonly referred to as "driving while black or brown"), or the use of race to determine which pedestrians to search for illegal contraband.

Which of the following was NOT a demand of the Populists?
A graduated income tax
Direct election of Senators
Ban on immigrants
Free coinage of silver

Answers

Answer: Direct election of senators

Explanation:

I know the 6 demands of the populists and I know direct election isn’t one. Hope it helps.

direct election of senators :)

Please help me i really need help!!!

Answers

The reason why some Hindu temples resemble mountains that that Hinduism is a nature-based religion.

What does it mean that Hinduism is nature based?

Hindus believe that the gods and goddesses are present in all of nature, including mountains. Mountains are seen as sacred places, and they are often associated with gods such as Shiva and Vishnu.

Mountains are often seen as a bridge between the human world and the divine world. The steep peaks of mountains represent the challenges that humans face on their journey to enlightenment.

The temples of Khajuraho were built to reflect these beliefs. They are designed to resemble mountains, both in their overall shape and in their many intricate carvings. The temples are also located in a mountainous region, which further reinforces their connection to the natural world.

Find out more on Hinduism at https://brainly.com/question/18156260

#SPJ1

Please help me out with the 3 questions for civics asap

Answers

Answer:

1. Congress should have the power to regulate interstate commerce

2. The commerce clause

3. It allows cooperation between federal and state agencies (I'm not too sure with this one)

Explanation:

Brainliest?

Answer:

1. Cov Congress yuav tsum muaj lub hwj chim los tswj kev ua lag luam interstate

2. Kev lag luam kab lus

3. Nws tso cai kev koom tes ntawm tsoomfwv thiab xeev cov koomhaum

Explanation:

Plz help will mark brainliest

how is the Panama Canal an example of big stick diplomacy

A: the united states allow Europe to colonize the country within the Western Hemisphere

B: the United States asserted his rights to be involved in the economic matters of a nation in the Western Hemisphere

C: the United States prevented a nation in the west hemisphere from Trading with any other nations

D: the United States allowed a nation in the Western Hemisphere to use military force ​

Answers

THE CONSTRUCTION OF THE PANAMA CANAL

As early as the mid-sixteenth century, interest in a canal across the Central American isthmus began to take root, primarily out of trade interests. The subsequent discovery of gold in California in 1848 further spurred interest in connecting the Atlantic and Pacific Oceans, and led to the construction of the Panama Railway, which began operations in 1855. Several attempts by France to construct a canal between 1881 and 1894 failed due to a combination of financial crises and health hazards, including malaria and yellow fever, which led to the deaths of thousands of French workers.

Upon becoming president in 1901, Roosevelt was determined to succeed where others had failed. Following the advice that Mahan set forth in his book The Influence of Seapower upon History, he sought to achieve the construction of a canal across Central America, primarily for military reasons associated with empire, but also for international trade considerations. The most strategic point for the construction was across the fifty-mile isthmus of Panama, which, at the turn of the century, was part of the nation of Colombia. Roosevelt negotiated with the government of Colombia, sometimes threatening to take the project away and build through Nicaragua, until Colombia agreed to a treaty that would grant the United States a lease on the land across Panama in exchange for a payment of $10 million and an additional $250,000 annual rental fee. The matter was far from settled, however. The Colombian people were outraged over the loss of their land to the United States, and saw the payment as far too low. Influenced by the public outcry, the Colombian Senate rejected the treaty and informed Roosevelt there would be no canal.

Undaunted, Roosevelt chose to now wield the “big stick.” In comments to journalists, he made it clear that the United States would strongly support the Panamanian people should they choose to revolt against Colombia and form their own nation. In November 1903, he even sent American battleships to the coast of Colombia, ostensibly for practice maneuvers, as the Panamanian revolution unfolded. The warships effectively blocked Colombia from moving additional troops into the region to quell the growing Panamanian uprising. Within a week, Roosevelt immediately recognized the new country of Panama, welcoming them to the world community and offering them the same terms—$10 million plus the annual $250,000 rental fee—he had previously offered Colombia. Following the successful revolution, Panama became an American protectorate, and remained so until 1939.

Once the Panamanian victory was secured, with American support, construction on the canal began in May 1904. For the first year of operations, the United States worked primarily to build adequate housing, cafeterias, warehouses, machine shops, and other elements of infrastructure that previous French efforts had failed to consider. Most importantly, the introduction of fumigation systems and mosquito nets following Dr. Walter Reed’s discovery of the role of mosquitoes in the spread of malaria and yellow fever reduced the death rate and restored the fledgling morale among workers and American-born supervisors. At the same time, a new wave of American engineers planned for the construction of the canal. Even though they decided to build a lock-system rather than a sea-level canal, workers still had to excavate over 170 million cubic yards of earth with the use of over one hundred new rail-mounted steam shovels. Excited by the work, Roosevelt became the first sitting U.S. president to leave the country while in office. He traveled to Panama where he visited the construction site, taking a turn at the steam shovel and removing dirt. The canal opened in 1914, permanently changing world trade and military defense patterns.

A photograph shows the excavation of the Culebra Cut in the construction of the Panama Canal.

Can someone write an Analytical Paragraph about the louisiana purchase? I gave away my hundred points but here's 23. please help it would mean a lot

Answers

Answer: The Louisiana Purchase eventually doubled the size of the United States, greatly strengthened the country materially and strategically, provided a powerful impetus to westward expansion, and confirmed the doctrine of implied powers of the federal Constitution.

(This might not be what you’re looking for, but I tried)

Explanation:

The Louisiana Purchase in 1803 represented the time when the United States expanded to the West by buying an area previously owned by France for the price of 15 million dollars.[2] The purchase represented the major diplomatic success of a young nation and an opportunity to double its size and become a leading power. The area purchased would later become “the states of Arkansas, Missouri, Iowa, Nebraska, South Dakota, almost all of Oklahoma and Kansas, and large portions of what is now North Dakota, Montana, Wyoming, Minnesota, Colorado, and Louisiana.”[3] The treaty represented an interesting view of the relations between France and the US that promoted the sale of Louisiana by Napoleon Bonaparte. Additionally, the treaty also served to bring in a major political battlefield between the Federalists and Republicans concerning Article III of the treaty, raising the questions of whether the president can sign treaties and incorporate new people of a gained territory into the union. This research paper will analyze the treaty and delve into the context behind the purchase of Louisiana by dividing it into three parts: the first part devoted to the relations between France and the US, the second to the provision of the treaty and the third to the consequences of the treaty on the constitution and its interpretation.

Wrote a whole essay for you my boy

Which Two countries fought during the War of 1812?

Answers

War of 1812, (June 18, 1812–February 17, 1815), conflict fought between the United States and Great Britain over British violations of U.S. maritime rights.

Answer:

the United States and Great Britain over British violations of U.S. maritime rights.

Mendel discovered that the Yellow color for Peas always showed over the Green color for Peas. He realized that the Yellow genes were stronger and called them what?
plzzzz helpp meee

Answers

Answer:

hi

Explanation:

Dominate gene. The yellow pea gene is dominant over the recessive green gene

What was the first permanent European settlement in what is now the United States?


A. Santa Fe


B. St. Augustine


C. San Diego

Answers

B. St. Augustine :) hope this helps
St. Augustine, its was pretty easy, good luck in your exam!

Who were the people who led the synagogues?

Answers

Answer:

According to the New Testament Gospels, Jesus often taught in synagogues, one of which was in Capernaum (Mark 1:21-28), in northern Israel. The book of Acts suggests that the apostle Paul also taught in synagogues (Acts 17:1-2). But what exactly were synagogues in the first century C.E.? Were they different from modern synagogues? The answers to these questions not only illuminate stories in the New Testament, they also shed light on the early years of an important Jewish institution.

Explanation:

Answer:

Although scholars used to assume that the Pharisees (the likely precursors to the rabbis) were in charge of synagogues, most first-century sources identify elders, priests, and archisynagogoi (Greek for “heads of synagogues”) as the leaders of synagogues (Philo, Hypothetica 7.12-3, Theodotus Inscription, Mark 5:22-23).

Explanation:

Other Questions
Can anyone please help me solve this?? A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 need helps pls will give thanks How are modern maps and ancient maps similar?a.They both feature three-dimensional drawings.b.They both rely on art and science for mapmaking.c.They both rely on paper-based drawings of an area.d.They both focus on the physical features of an area. 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC Only________ can declare war! RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! Name the factors in each of the following problems i need help lol i forgot how to do this Q.Ankit said to Rita, " It is your last chance." 1.Ankit said Rita it is your last chance. 2.Ankit told Rita that it is her last chance. 3.Ankit told Rita that it was her last chance. 4.Ankit told Rita that it was their last chance.