How can I tell if a system of equations has one, no, or infinitely many solutions?

Answers

Answer 1

Answer:

There are many ways to interpret if whether or not a system of equations has solutions or not. Here is one way that is most ideal for most, if not, all equations: using graphs.

If the graphs of the set of equations do NOT intersect, then there are no solutions (because no x or y value will ever make both equations true)If the graphs of the set of equations DO intersect at one point, then ONLY that one point will make both equations true. (One solution)If the graphs of the set of equations are identical on the graph, then there are infinite solutions that make both equations true.


Related Questions

PLEASE SOMEONE!!HELP!! I need the answer right now

Answers

Answer:

m = -1, b = 5.

Step-by-step explanation:

We can find the slope, m, by plugging in our coordinates into the slope formula: [tex]\frac{y2-y1}{x2-x1} =\frac{2-7}{3-(-2)}=\frac{-5}{5}=-\frac{5}{5}=-\frac{1}{1}=-1[/tex]. That gives us the slope. Now we can fill that in the slope intercept formula: [tex]y=-1x+b[/tex]. We know one of the coordinates and the slope, which allows to find the y-intercept. We know that for every 1 unit down on the line, we move 1 unit right, and vice versa. Meaning we can just count down (or up in this case), so, (-2, 7), (-1, 6), (0, 5). Therefore, our y intercept is 5.

Sean's party will cost $60 if he invites 12 guests. Which expression does NOT equal the amount that Sean will spend per party guest in dollars?

Answers

Options :

A) 12⟌60

B) 60 ÷ 12

C) 60⟌12

Answer:

C) 60⟌12

Step-by-step explanation:

Given that :

Total cost of inviting 12 guests to a party = $60

To obtain the cost per guest :

Total cost of invitation / number of guests

That is ; we divide the cost of inviting the guests by the number of guests invited

$60 / 12 = 12⟌60

The expression 60⟌12 is incorrect as this means 12 / $60

Peter buys tickets for his family to see his favorite movie, Elephant Mistake. He pays $37.50 for 2 adult tickets and 2 student tickets. The next week he goes back with his friends and pays $35.25 for 1 adult ticket and 3 student tickets. Choose the system of equations that can be solved to find the price of an adult ticket, x, and the price of a student ticket, y.

Answers

Answer:

the price of adult ticket and student ticket be $10.50 and $8.25 respectively

Step-by-step explanation:

Let us assume the price of adult ticket be x

And, the price of student ticket be y

Now according to the question

2x + 2y = $37.50

x + 3y = $35.25

x = $35.25 - 3y

Put the value of x in the first equation

2($35.25 - 3y) + 2y = $37.50

$70.50 - 6y + 2y = $37.50

-4y = $37.50 - $70.50

-4y = -$33

y = $8.25

Now x = $35.25 - 3($8.25)

= $10.5

Hence, the price of adult ticket and student ticket be $10.50 and $8.25 respectively

Choose the system of equations to solve the following: Tickets to a movie cost $7.25 for adults and $5.50 for students. A group of friends purchased 8 tickets for $52.75. Determine the total number of adult and student tickets. *

A: 7.25a + 5.50s = 8 and a + s = 52.75
B: 7.25a + 5.50s = 52.75 and a + s = 52.75
C: 7.25a + 5.50s = 52.75 and a + s = 8

Answers

UMMMMMMMMMMMMMMM I don't know

Solve Each system using elimination

Answers

Answer:

No solution

Step-by-step explanation:

The given system of equations are ,

3x - y = -1 y = 3x - 5 = y-3x = -5

Adding both equations ,

=> 3x - y + y -3 x = -1-5

=> 0 = -6

Since we arrived at a contradiction the given pair of equations have No solution .

Help me with this please!!!!

Answers

Answer:

yes

Step-by-step explanation:

it said it is a perpendicular BISECTOR, H is the mid point of KI, HK = 7

[tex]\huge{\underline{\underline{\boxed{\sf{\red{Answer࿐}}}}}}[/tex]

Yes!

Find the modes of this data set.

Answers

Answer:

1, 2

Step-by-step explanation:

the mode is the ones that appear the most in a data set, so since 1 and 2 appear 4 times each, they are the two modes.

Mikeply o binomial by a trinomial
(x-1) (x²+x+1)​

Answers

Answer:

See if this is helpful

Answer:

x³ - 1

Step-by-step explanation:

Given

(x - 1)(x² + x + 1)

Each term in the second factor is multiplied by each term in the first factor, that is

x(x² + x + 1) - 1(x² + x + 1) ← distribute parenthesis

x³ + x² + x - x² - x - 1 ← collect like terms

= x³ - 1

(-8,-2);m=3/4 in point slope form

Answers

Answer:

         y + 2 = ³/₄(x + 8)

Step-by-step explanation:

The point-slope form of the equation that describes the line with a slope of m and containing the point (x₀, y₀) is: y - y₀ = m(x - x₀)

m = ³/₄

(-8, -2)  ⇒    x₀ = -8,  y₀ = -2

Therefore:

y - (-2) = ³/₄(x - (-8))

y + 2 = ³/₄(x + 8)

hat is the value of x rounded to the nearest hundredth?





Question 5 options:

9


3


11


5

Answers

Answer:

3 might be wrong

Step-by-step explanation:

2

(✓7) - 4x4=9

✓9

3

There are 68 marbles in a bin and 50% of the marbles are red.
How many red marbles are the bin?
There are
red marbles in the bin. .

Answers

Answer:

34 because 50 percent of 68 is 34

Answer:

There are 34 red marbles in the bin

Step-by-step explanation:

50% is basically 1/2. So half of 68 is 34.

Leonard plans to build a garage on a square plot of land. If one side of the plot is 6g3h5 feet long, express the area of his plot as a monomial

Answers

Answer:

[tex]Area= 36g^6h^{10}[/tex]

Step-by-step explanation:

Given

[tex]Length = 6g^3h^5[/tex]

Required

Determine the area as a monomial

This is calculated as:

[tex]Area = Length * Length[/tex]

[tex]Area= 6g^3h^5*6g^3h^5[/tex]

This can be rewritten as:

[tex]Area= 6*6*g^3*g^3*h^5*h^5[/tex]

Apply law of indices

[tex]Area= 36*g^6*h^{10}[/tex]

[tex]Area= 36g^6h^{10}[/tex]

A couple decides to keep having children until they have a girl, at which point they will stop having children. They also agree to having a maximum of three children. The table below shows the probability distribution of X=, equals the number of children such a couple would have.
X=# of children 1 2 3
P(X), .5 .25 .25
Given that \mu_X=1.75μ
X

=1.75mu, start subscript, X, end subscript, equals, 1, point, 75 children, find the standard deviation of the children such a couple would have.
Round your answer to two decimal places.
\sigma_X\approxσ
X

≈sigma, start subscript, X, end subscript, approximately equals
children

Answers

Answer:.83

Step-by-step explanation:

Khan academy

From the discrete distribution given, the standard deviation is of 0.83 children.

The distribution is:

[tex]P(X = 1) = 0.5[/tex]

[tex]P(X = 2) = 0.25[/tex]

[tex]P(X = 3) = 0.25[/tex]

The mean is 1.75.The standard deviation is the square root of the sum of the difference squared between each value and the mean, multiplied by it's respective probability.

Hence:

[tex]\sqrt{V(X)} = \sqrt{0.5(1 - 1.75)^2 + 0.25(2 - 1.75)^2 + 0.25(3 - 1.75)^2} = 0.83[/tex]

The standard deviation is of 0.83 children.

A similar problem is given at https://brainly.com/question/24188569

Which if the following is a geometric sequence?
Question 5 options:
A. 6,8,10,12
B. 3,6,12,24
C. 12,6,2,1
D. 5,-15,45,135

Answers

I think the answer is B.....

8. A store owner paid $15 for a book. She marked up the price of the book by 40% to determine its selling price. What is the selling price of the book?

Answers

Answer:

21

Step-by-step explanation:

Simplify and leave in radical form.

Answers

Answer:

Step-by-step explanation:

Expressing in simplest radical form just means simplifying a radical so that there are no more square roots, cube roots, 4th roots, etc left to find. It also means removing any radicals in the denominator of a fraction.

mark me as brill

I will give brainliest, I just need to see if my answer I wrote down was correct

Answers

Answer:

143m

Step-by-step explanation:

Help. Anyone. ......

Answers

I believe its 4/5 slope

Find the value of x and the measure of the angle labeled 3x
3x
27
A. x= 15; angle measure is 27°,
OB. X = 9; angle measure is 27".
C. x= 9; angle measure is 45°
O.D. x= 15; angle measure is 45°

Answers

Answer:

The angles of A and B are 45 degrees. This is true because the other angle is a right angle (90 degrees) and if you are making a triangle the degrees of the sides have to = 180 to be a complete triangle. The triangle is complete, so I took 180 – 90 = 90 ÷ 2 = 45.

The angle of C is 115 because it is a supplementary angle. A supplementary angle is an angle that has two angles with a sum of 180 degrees and 180 – 65 = 115The angles of A and B are 45 degrees. This is true because the other angle is a right angle (90 degrees) and if you are making a triangle the degrees of the sides have to = 180 to be a complete triangle. The triangle is complete, so I took 180 – 90 = 90 ÷ 2 = 45.

The angle of C is 115 because it is a supplementary angle. A supplementary angle is an angle that has two angles with a sum of 180 degrees and 180 – 65 = 115The angles of A and B are 45 degrees. This is true because the other angle is a right angle (90 degrees) and if you are making a triangle the degrees of the sides have to = 180 to be a complete triangle. The triangle is complete, so I took 180 – 90 = 90 ÷ 2 = 45.

The angle of C is 115 because it is a supplementary angle. A supplementary angle is an angle that has two angles with a sum of 180 degrees and 180 – 65 = 115The angles of A and B are 45 degrees. This is true because the other angle is a right angle (90 degrees) and if you are making a triangle the degrees of the sides have to = 180 to be a complete triangle. The triangle is complete, so I took 180 – 90 = 90 ÷ 2 = 45.

The angle of C is 115 because it is a supplementary angle. A supplementary angle is an angle that has two angles with a sum of 180 degrees and 180 – 65 = 115The angles of A and B are 45 degrees. This is true because the other angle is a right angle (90 degrees) and if you are making a triangle the degrees of the sides have to = 180 to be a complete triangle. The triangle is complete, so I took 180 – 90 = 90 ÷ 2 = 45.

The angle of C is 115 because it is a supplementary angle. A supplementary angle is an angle that has two angles with a sum of 180 degrees and 180 – 65 = 115The angles of A and B are 45 degrees. This is true because the other angle is a right angle (90 degrees) and if you are making a triangle the degrees of the sides have to = 180 to be a complete triangle. The triangle is complete, so I took 180 – 90 = 90 ÷ 2 = 45.

The angle of C is 115 because it is a supplementary angle. A supplementary angle is an angle that has two angles with a sum of 180 degrees and 180 – 65 = 115The angles of A and B are 45 degrees. This is true because the other angle is a right angle (90 degrees) and if you are making a triangle the degrees of the sides have to = 180 to be a complete triangle. The triangle is complete, so I took 180 – 90 = 90 ÷ 2 = 45.

The angle of C is 115 because it is a supplementary angle. A supplementary angle is an angle that has two angles with a sum of 180 degrees and 180 – 65 = 115

Step-by-step explanation:

hii please help i’ll give brainliest!!

Answers

Answer:

direction

Step-by-step explanation:

What is the area of the given circle use 3.14 for pie diameter =18cm

Answers

Answer:

254.47

Step-by-step explanation:

1/4[tex]\pi[/tex]d^2

write the equation (3,5) in standard form

Answers

Answer:

We can write out 3! (three factorial) as 3x2x1, and we can write out 5! as 5x4x3x2x1. This means that, since 3x2x1 is on the top and the bottom of the fraction, it cancels out. This leaves us with 1 on top, and 4x5=20 on the bottom.

Step-by-step explanation:

can you please help me with my question

how to write an essay about citisenship

Answers

Essay Definition of Citizenship:

In the literal sense a person who lives in a city is said to be a citizen. But in political science we use this terminal different sense. To find the real meaning of the term we are to go back to ancient Greece. Aristotle, the father of political science, called a person a citizen who would take a direct and active part in the administration of the state.

Since the states in ancient Greece were as small as the cities of Greece it was possible for the residents of the city-state to make law, to adjudicate and even enforce the law. These citizens did not include the slaves, women and manual workers. In such a case the number of the citizens was just half of the entire population. The position was not very different in the medieval Europe. There were serfs in the place of the slaves.

The position is quite different in modern nation-states, where all adult people are citizens who need not take an active part in the administration of the country, because it is not possible for the entire population of a vast country to meet together and make law and interpret it or enforce it.

help plzzzzzzzzzzzzzz​

Answers

Answer:

a) 20ft

Step-by-step explanation:

just multiply the model length and the scale factor

A)20 Ft hope I’m not too late for you

Please someone answer this!
Andrew has $90 in a savings account. The interest rate is 10% per year and is not compounded. How much interest will he earn in 2 years?

Answers

Answer: 108$

Step-by-step explanation:

find the length . IF necessary round to the tenth

Answers

Answer:

24

Step-by-step explanation:

Finding the lengths of a Triangle is [tex]a^{2}[/tex] + [tex]b^{2}[/tex] = [tex]c^{2}[/tex]

Your triangle is [tex]7^{2}[/tex] + [tex]b^{2}[/tex] = [tex]25^{2}[/tex]

Which is 49 + b = 625

Subtract the difference 625 - 49. then you get the following

b = 576

Finally find the square root of this number and that's your answer: 24

Answer:

by using Pythagoras law

third side =√(25²-7²)=24

Factorise the exprssions
x^2-ax-bx+ab

Answers

Answer:

[tex](x - a)(x - b)[/tex]

Step-By-Step Explanations:

1) Factor out the common term in the first two terms, then in the last two terms.

[tex]x(x - a) - b(x - a)[/tex]

2) Factor out the common term x - a.

[tex](x - a)(x - b)[/tex]

Therefor, the answer is ( x - a ) ( x - b ).

plea help I will give brainiest

Answers

Answer:b

Step-by-step explanation:

l x w x h

w² + 2w – 24/ + 8/
w² + w – 30 w-5​

Answers

Use photomath it’s faster and you get correct Answers!<3 have a good day

PLEASE Can someone plz help me

Answers

9514 1404 393

Answer:

  $11,988

Step-by-step explanation:

A graphing calculator gives you the answer easily.

The minimum unit cost is $11,988.

__

The equation for unit cost can be put into vertex form to find the minimum.

  C(x) = 0.7x^2 -210x +27738

  C(x) = 0.7(x^2 -300x +150^2) +27738 -0.7(150^2)

  C(x) = 0.7(x -150)^2 -11,988

This is vertex form:

  C(x) = a(x -h)^2 +k . . . . . . . where (h, k) is the vertex.

The vertex of this cost function is (150, 11,988).

The minimum unit cost occurs when 150 engines are produced. That unit cost is $11,988.

Answer:

the answer is $11,988

Step-by-step explanation:

:)

Other Questions
Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 (HELP ASAP)Select the graph which best represents this scenario:The amount of pancake batter that you must mix increaseswith the number of people who come to breakfast. It takes3 cups of batter to serve 10 people.(More context in the picture) What is not a type of text format that will automatically be converted by Outlook into a hyperlink?O email addressO web addressO UNC pathO All will be automatically converted. Cup G has a diameter of 4 in. and a height of 8 in. Find the volume of Cup G. Where dose the earliest known Indian literature come from which element is shown in the picture here? Grapes cost $3.25 per pound. Darius paid a total of $26 for grapes.How many pounds of grapes did Darius buy? Which time interval has the greatest speed? resulve las siguientes operaciones matematicas en tu cuadernk PLEASE HELP! Please help me I dont understand how to do this and it has to be done by tonight!!! what effects can war have on politics and society?