Hurry!!

Francis Marion, also know as the Swamp Fox, used guerrilla
warfare while fighting the British in the South. Was Francis
Marion successful in using these techniques with his troops?
Explain why or why not.

Answers

Answer 1

Answer:

use ur brain and pay attention in class

Explanation:

Answer 2

Answer:

yes because he was able to maneuver through the swamps and avoid and distract British forces and win battles through stealth and other resourceful tactics

Explanation:


Related Questions

A system for manufacturing a product is called a:

quarry
process
industry
scheme

Answers

The system for manufacturing a product is called a process because it combination creates a product.

What is a manufacturing system?

Basically, a manufacturing system refers to any combination of processes used throughout the production of any goods.

Hence, the system for manufacturing a product is called a process because it involves combination of those process to create a product.

Therefore, the Option B is correct.

Read more about manufacturing system

brainly.com/question/1104872

GIVING BRAINLEIST+20 POINTS

What was one restriction placed on free African Americans?
O A. They were responsible for paying for the freedom of their enslaved
OB. They had to pay for public services that were free for white
OC. They were not allowed to participate in antislavery organizations.
D. They were forbidden in many states to learn to read and write.
relatives.
Americans.

Answers

Answer: FIXED VERSION: D, They were forbidden in many states  to learn to read and write. Such as in a story this African American girl, had bodyguards to get into a school but her parents had the money because she was so smart that she got in but there were no other african americans with her. Many african americans had their own way less educated schools. I hope this helped anyone who finds it

Explanation:

Answer:

D

Explanation:

The group of men that took Fort
Ticonderoga for the Americans
was known as the

A. Redcoats
B. Green Mountain Boys
C. Sons of Liberty

Answers

Answer:

C

Explanation:

B. Green mountain boys

How was Montesquieu wrong about the English government?

Answers

Answer: First, Montesquieu thought that the primary exercise of powers could durably be divided only where those powers differed in kind. Second, Montesquieu failed to recognize the lawmaking character of executive and judicial exposition of existing law.

Explanation:

what are 2 consequences of the Coercive Acts

Answers

The answer is In Great Britain, these laws were referred to as the Coercive Acts. The acts took away self-governance and rights that Massachusetts had enjoyed since its founding, triggering outrage and indignation in the Thirteen Colonies. They were key developments in the outbreak of the American Revolutionary War in April 1775.

What is the name of the image below?

Answers

I think it’s “Portrait of a German Officer.”

Explain how the historical context affected a development taking place in the document

Answers

Answer:

The introduction to the specific rubric may take place once the Uniform Statewide. Admission ... the document, but it will be related to information in the document. ... Explains how audience affects the way Daniel Fitzpatrick presents his ideas ... Explain the geographic context for the historical development shown on this map.

Explanation:

NEED AN ANSWER FAST!
what two things did Noah Webster do to improve education and help build a unique American identity?

Based on Williams Holmes McGuffey what are three common educational practices that began with the use of McGuffey readers? How did they represent improvements in education?

Answers

(1).

During the 1780s Webster wrote numerous essays promoting education reform and other cultural concerns, went on a national lecture tour, established the American Magazine, promoted the sales of his textbooks, and worked to advance copyright law.

(2).

They used word repetition in the text as a learning tool, which built strong reading skills through challenging reading. Sounding- out, enunciation and accents were emphasized.

Answer:

McGuffey helped students in the development of students' grammar knowledge; McGuffey's Readers were the first readers to be challenging for the students every time, but this will work on the students' skills in reading. McGuffey worked with the students on Sounding out and pronunciation. He taught lessons by using the phonics method. This reader benefitted so many students on their reading skills and grammar. He also shaped many people's viewpoints on character and civilization.

Explanation:

100%

Is there another way to say common defense?

_____ security

Answers

Answer:

slang) practicality, prudence, reasonableness, smarts, sound judgment, soundness, wit.

That's what I know :)


What were Martin Luther's complaints against the Catholic Church?

Answers

Answer:

On 31 October 1517, he published his '95 Theses', attacking papal abuses and the sale of indulgences. Luther had come to believe that Christians are saved through faith and not through their own efforts. This turned him against many of the major teachings of the Catholic Church.

Explanation:

Answer:

Explanation:attacking papal abuses and the sale of indulgences.

The three parts system of the US government allows for system of checks and balances. True or false?

Answers

True because not one branch has significant advantage over the other.

Answer:

Explanation:

true But neither of the three have more power than the other. ( please give BRAINLIEST)

why did texas want independence from mexico

Answers

Answer:

Texas was separated from most of Mexico by large swaths of desert with little in the way of roads. For those Texans who produced export crops, such as cotton, it was far easier to send their goods downstream to the coast, ship them to a nearby city like New Orleans, and sell them there

Explanation:

What is one of the major differences between Catholic and Protestant theology?
O Catholics have the Holy Eucharist, Protestants have Lord's Supper
O Catholics go to Mass led by a priest, Protestants go to services held by a preacher
O Catholics have a pope, Protestants do not
O Catholics celebrate saints, Protestants do not

Answers

The correct answer is C) Catholics have a pope, Protestants do not.

One of the major differences between Catholic and Protestant theology is that Catholics have a pope, Protestants do not.

Of course, there are many differences between Protestant and Catholic religions. But one of the most notable differences is that the Catholic Church is led by the pope in Italy; the Vatican, to be more specific. Protestants do not have a pope.

Indeed, that was one of the main reasons for the separation or the split of the church. German monk Martin Luther accused the pope and the Catholic church of selling indulgences and he critiqued this, saying that it was not moral and correct. He wrote this and other interesting ideas in his essay "95 Theses."

Answer:

C - Catholics have a pope, Protestants do not

(got it correct on my test)

Explanation:

The Catholic Church believes in papal authority: the Pope is the supreme authority on Earth and that he receives divine knowledge and leadership from God. Protestants believe that there is no need for a pope. Each individual can speak freely with God and has no need for an emissary. Another major difference is that Protestants believe salvation comes through faith in God alone, while Catholics believe that attending mass and following church teaching will guarantee salvation.

Explain the quote by Peter the great

Answers

Answer:

Hes saying he put the empire first before himself.

Put the empire before myself

*PLZZZZ HELLPPPP

Which natural rights are listed in the Declaration of Independence?

Check all answers that are correct.
Property
Right to bear arms
Right to vote
Pursuit of Happiness
Liberty
Life

Answers

life, liberty, and the pursuit of happines

1. Who does the person on the left represent (look at what he’s holding)?
2. Who does the person on the right represent (holding)?
3. What is the main idea of the cartoon?
4. What do you believe was the general perception of the Populist Party at the time?

Answers

Answer:

4.what do you believe was the general perception of the populist party at the time

What negative things occurred as a result of the railroad? Explain your answer.

Answers

Answer:

The railroad had a negative impact on the Plains Indians. They were forced to move away from the railroad despite it running through Indian Territory. The workers often killed buffalo for meat, and the track itself disrupted the Plains Indians buffalo hunting.

Explanation:

How did John Locke theories influence the Declaration of Independence. Select two answers

Answers

His theories on natural rights led the text to mention life, liberty, and the pursuit of happiness.

Answer:

i know a lot about locke

Explanation:

His theories on natural rights led the text to mention life, liberty, and the pursuit of happiness.

hope this helps

If you were the President of the U.S.A right now, what would you do to reassure the citizens that our democracy is not lost, and that this scene at the US Capitol does not depict the future of America?

Answers

Answer:

We should all have are opinions and not to judge them

Explanation:

IM JUST A KID

(02.02 MC)

How is the principle of "rule of law" evident in the Constitution? (4 points)

Select one:
a. It lists the laws of the country and gives states the power to enforce them.
b. It creates a government that can make, enforce, and review its own laws.
c. It grants the executive branch the power to make and execute the laws.
d. It provides a method for making laws that the court system carries out.

Answers

Answer:

A

Explanation:

it lists the law of the country and gives the state the power to enforce them... The rule of law being the supreme law of the land, nobody is above the law, it applies to everyone and everyone must stick to the law and do what it says to avoid Anarchy.

Your welcome

What does the sensory language in stanza three of stopping by the woods on a snowy evening help the reader imagine? A--what speaker will do next. B--when a horse mike rebel against its writer. C--The sound of quiet woods during snowfall. D-- speakers feelings about his horses behavior

Answers

Answer:

.

Explanation:

Which was the last English colony founded in North America?
A.
Carolina
B.
New Orleans
C.
Detroit
D.
Georgia
E.
Pennsylvania

Answers

Answer:

it is Georgia it was founded in 1733

Answer: The correct answer is Georgia

2. What is the difference between a
state and a nation?

Answers

Answer:A nation is a big amount of people that got to a specific territory and they connect by history, culture, etc..

A state is terriory with its own population and traditions/institutions

Explanation:

What are the Ten Commandments? Why are the Ten Commandments important
to the Hebrews?

Answers

Answer:

the ten commadments are I am the LORD thy God.

No other gods before me.

No graven images or likenesses.

Not take the LORD's name in vain.

Remember the sabbath day.

Honour thy father and thy mother.

Thou shalt not kill.

Thou shalt not commit adultery.

Explanation: this was important to the hebrews because this is how they know what and what not to do.

Answer:

I think the answer is Laws that Hebrews must obey.

Explanation:

I took the K12 test.

In 1519, the first Native Americans introduced to Hernando Cortés of Spain were the _____.


A.) Aztecs

B.) Incas

C.) Hohokam

D.) Mayas

Answers

Answer: Aztecs

Explanation:

A is the correct answer

What did Peter learn during his travels to Western Europe?

Answers

Answer: In 1697, Peter the Great of Russia traveled to England to learn about shipbuilding and navigation in order to establish the first Russian Navy. As a young man, he traveled to Europe in 1697–98 to study new developments in technology, especially shipbuilding

Explanation: ;)

Answer:

Western manufacturing techniques and customs

Explanation:

hope it helps

What were Scalawags?
A. were southerners who supported the South during the Civil War and Republicans after it.
B. were southerners who supported the North during the Civil War and Republicans after it.
C
C. were southerners who supported the North during the Civil War and Democrats after it.

Answers

b. southerners who supported the north during the civil war & republicans after it.
Yeah whatever that means

Describe what irrigation is and why it is important.​

Answers

Answer:

Irrigation is a way of watering plants. There are many types of irrigation. Such as drip irrigation,  surface irrigation, and sprinkler irrigation. Irrigation is mostly seen as channels of water helping to water plants.

Explanation:

Which examples show the meaning of barter?

Answers

Answer:

1,3,4

Explanation:

i took this on a test.

1 3 4
I got it right on my test

Why was "The Virgin and Child with Saints and allegorical figures" painted?
A.As decoration for a cathedral.
B.As decoration for a tomb.
C.To hold a cloak up - jewelry
D.To indicate the presence of an early monastery.

Answers

Answer:

answer a

Explanation:

church related

Other Questions
The Venn diagram below shows some of the services provided by national and state governments.Which service completes the Venn diagram? (3 points)A. Raise and collect taxesB. Declare war and make peaceC. Make marriage lawsD, Coin and print money DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What caused the original creation of the Universe? How do we find out? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Please help with this Spanish work. The topic is Superlatives. One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution plz help me with this 1) Choose the correct answer. I NEED HELP ASAPThe destination of many Roman Catholic pilgrimages was ______.the Holy Landthe Holy Roman EmpireAfricaKievRome The incidence of cystic fibrosis, a recessive genetic disorder in the Caucasian population of United States, is 1 in every 2,500 individuals. Find the number of heterozygous carriers. (p + q = 1, p2 + 2pq + q2 = 1) An appropriate strategy to learn difficult vocabulary words is the a. Keywords technique c. Rhyming Technique b. Visualization technique d. None of these Please select the best answer from the choices provided A B C D What must occur to produce electric current? Which atom is involved in giving your heart energy to beat? O carbonO gold O oxygenO iron wut anime do u guys watch comment down below and you'll get brainliest as well 2x2 just in case it would deleted i will also put math equations 2x3x4x5 Need help finding x. What determines which bases will be brought to the DNA strand during DNA replication?