I WILL BRAINLIEST PLS HELP ME I NEED HELP PLS ,
If 2 cm = 5 ft, what is the area of the playground?

I WILL BRAINLIEST PLS HELP ME I NEED HELP PLS ,If 2 Cm = 5 Ft, What Is The Area Of The Playground?

Answers

Answer 1

Answer:

Step-by-step explanation:

Ok so

2 cm is 5 feet and there are 24

2 = 5

4 = 10

6 = 15

8 = 20

10 = 25

11 = 30

So for this one there are about . 10 feet at the top and 8 feet for the other

Answer 2

Answer:

The scale of the drawing is

Step-by-step explanation:

we know that

If two figures are similar, then the ratio of its areas is equal to the scale factor squared

Let

z-----> the scale drawing

x-----> the area of the playground in the scale drawing

y----> the area of the actual playground

we have

substitute

simplify

or

Divide by 4 both numerator and denominator


Related Questions

What is measure p angles has 5 sides

Answers

Answer:

[tex]\huge\boxed{m\angle P = 94\textdegree}[/tex]

Step-by-step explanation:

In order to answer this question, we need to note a couple of things about the angle relationships in a pentagon.

A) The sum of the measures in a pentagon will be 540° (We know this because the angle sum formula tells us that an n sided polygon angles will have a sum of  [tex](n-2) \cdot 180[/tex] - 180 * 3 = 540).B) Equations can represent angle measures, added together will help us determine their value.

Since we know the sum of all of the angles will be 540, we can create an addition statement to find out the value of x.

[tex]132 + (4x-10) + (5x-11) + 128 + (4x+2)=540[/tex]

Let's solve for x.

Combine the angles we already know:[tex]132 + 128 =260[/tex] Combine like terms: [tex]260 + 13x - 19=540[/tex] Add 19 to both sides, subtract 260 from both sides: [tex]13x =299[/tex] Divide both sides by 13: [tex]x = 23[/tex]

Now that we know the value of x, we can substitute it into the expression for point P ([tex]4x+2[/tex]) to find it's value.

[tex]4 \cdot 23 + 2[/tex] [tex]92+ 2[/tex] [tex]94[/tex]

Therefore, the angle of measure P is 94°.

Hope this helped!

--6x = 48 (solving equations)

Answers

if your solving for X your answer will be -8 im glad to help! have a nice day~

Graph 16x−4y=2.Please answer I will make you the brainlist and rate you 5 stars if good.And report if bad.

Answers

Answer:

First one is the graph second one is the equation

Step-by-step explanation:

Hope this helps :)

Answer:

Step-by-step explanation:

as graphed

which expression is equivalent to 15+8x+3+2x​

Answers

Answer:

10x + 18

Step-by-step explanation:

First, we need to add like terms. Like terms are terms that are alike. For instance 8x and 2x are like terms. 15 and 3 are also like terms.

So, we have to add 8x plus 2x and 15 plus 3. That’s comes out to 10x plus 18.

Therefore, this expression is equivalent to 10x + 18.

-49-X = -8x + 70
helppp

Answers

Answer:

x=17

Step-by-step explanation:Get everything to one side by using addition and subtraction and combine like terms. Once you have that set it equal to zero and put the b in Mx+b on the other side then divide it by m and you’ll have x

3.2 - 5.1n - 3n + 5= n +8.2 can someone tell me what goes in the blank

Answers

The answer for (n) is 0

A store pays $13 for a bicycle helmet and marks up the price by 40% what is the amount of the mark-up?

Answers

Answer:

Step-by-step explanation:

the amount of mark up is

13*(40/100)=5.20

pls help a.s.a.p!!!!!

Answers

Answer:

The correct answers are A and E

Step-by-step explanation:

What’s is 9 divided by 3/10

Answers

Answer:

30

Step-by-step explanation:

9/(3/10)=9*(10/3)=30

What is the value of 9(4x - 4) when x = 5

Answers

Answer:

144

Step-by-step explanation:

plug in 5 where you see the x.

that gives us 9(4(5)-4)

multiply the 4 and the 5 first to get 9(20-4)

and by PEMDAS, we solve the parentheses first so now we have 9(16)

so now just multiply 9x16 to get 144

Step-by-step explanation:

9((4×5)-4)

9(20-4)

9(16)

144

The sum of 1 and a number x

Answers

9515 1404 393

Answer:

  1 + x

Step-by-step explanation:

A sum is found by adding terms. Here, you are told the terms to add are 1 and x. We use the plus sign (+) to signify addition. Your sum is ...

  1 + x

8+3(p-9)
Pleaseeee helppp

Answers

Answer:

3p - 19

Step-by-step explanation:

8 + 3(p - 9)

Distribute;

8 + 3p - 27

Collect like terms;

-19 + 3p

3p-19 by using addition and the distributive property

In which direction must the graph of f(x) = |x| be shifted to produce the graph of g(x) = |x − 3|?

A.
left
B.
down
C.
up
D.
right

Answers

Answer:

In which direction must the graph of f(x) = |x| be shifted to produce the graph of g(x) = |x − 3|?

A. left

B. down

C. up

D. right

Right is the right answer.

Answer:

Down

Step-by-step explanation:

I took the test and got it right

Nada is making square coasters with sides of 3 inches. On each coaster is a circular design. What is the radius of the largest circle that fits on one of the coasters?

Answers

Answer:

1.5

Step-by-step explanation:

diameter is half the length of the circle so if it is 1.5 the full length will be 3 inches which is the full length of the coaster

Use the scale factor to find the area of the enlarged figure. Explain your steps.


A small rectangle has a length of 8 and width of 4. A large rectangle has a length of 25.6 and width of a.

Answers

9514 1404 393

Answer:

  327.68 units^2

Step-by-step explanation:

The area of the small figure is ...

  area = length · width

  area = (8)(4) = 32 . . . . square units

The scale factor is ...

  scale factor = large length / small length = 25.6/8 = 3.2

The area of the larger rectangle will be the small rectangle area multiplied by the square of the scale factor:

  (32 units^2)(3.2^2) = 327.68 units^2

_____

Additional comment

We note the width is half the length, so we could figure the larger rectangle's width at 25.6/2 = 12.8 units. Then its area would be

  length · width = (25.6 units)(12.8 units) = 327.68 units^2

This seems easier to me, but is not the method required by the problem statement.

Answer:

The scale factor of the enlargement is 3.2. Square the scale factor to get 10.24. Find the area of the original figure, which is 32. Multiply 32 and 10.24 to get the area of the enlarged figure, which is 327.68.

Step-by-step explanation:

This is the sample response but I would use the other pearsons answer because it is NOT the sample response.

Have a great day!

A rectangle has a length of 3x + 7 and a width of 2x. If the perimeter of the
rectangle is 94 units, what is the length of the rectangle.

Answers

Answer:

The length of the rectangle is 31.

Step-by-step explanation:

We have that the length (L) and width (W) are:

[tex] L = 3x + 7 [/tex]

[tex] W = 2x [/tex]

The perimeter of the rectangle is given by:

[tex] P = 2W + 2L [/tex]

[tex] 94 = 2(2x + 3x + 7) [/tex]

[tex] 94 = 10x + 14 [/tex]

[tex] x = 8 [/tex]

Now, we can calculate the length of the rectangle:

[tex] L = 3x + 7 = 3*8 + 7 = 31 [/tex]        

         

Therefore, the length of the rectangle is 31 units.

I hope it helps you!                

What is the value of q?
52 589
9

Answers

I believe the answer is 55

Andrea earns $32.25 a day. After 9 days , about how much will she have earned?

ESTIMATE

Answers

270? not completely sure.

Which is the percent for 1.67

Answers

The percent is 167% have a good day

Answer:

167%

i thank that is the anserr.

Step-by-step explanation:

Solve for x.
-1+4x5= 3

Answers

Answer:

[tex]x = 0.2 \: or \: \frac{1}{5} [/tex]

Step-by-step explanation:

[tex] - 1 + 4x.5 = 3[/tex]

[tex] = > 20x - 1 = 3[/tex]

[tex] = > 20x = 3 + 1 = 4[/tex]

[tex] = > x = \frac{4}{20} = \frac{1}{5} = 0.2[/tex]

If the radius of a circle is 5 inches, what is the diameter of that circle? Show
your work and label your answer.

Answers

Answer:

If the radius of a circle is 5 inches, the diameter is 10.

Step-by-step explanation:

This is because to find the diameter of a circle sing the radius is to multiply it by two. 5x2=10

So the diameter is 10. If you want to find the radius just reciprocate the process, divide the diameter by 2 and yo will get the radius.

I really hope this helped you out. Make sure to give my answer brainliest. Have a radiant day or night ! :D

A ladder 5 m long, leaning against a vertical wall makes
an angle of 65° with the ground. How far up the wall is
the top of the ladder?

Answers

The height of the top of the ladder from the ground is 4.53 m

Step-by-step explanation:

Given:

length of ladder =5 m

Angle formed = 65°

Let h be the Height of the top of the ladder from the ground

Required:

Height of the top of the ladder from the ground

Equation:

SOH-CAH-TOA

Since the hypotenuse side is given and what we are to solve is the opposite side, use SOH

[tex]sinθ\:=\: \frac{opposite}{hypotenuse}[/tex]

[tex]sin(65°)\:=\: \frac{opposite}{5\: m}[/tex]

[tex]opposite\:=\:(5 \:m )\:sin(65°)[/tex]

[tex]opposite\:=\:4.53 \:m[/tex]

Final Answer:The height of the top of the ladder from the ground is 4.53 m

Please refer to the photo for the illustration

How many solutions exist for the given equation?
x+12) = 4x-1
EEEE
O zero
O one
two
O infinitely many

Answers

Answer:

One answer exists for this equation.

Based on the table, which function represents the same relationship? The x column has 0, 1, 2, 3. The y column has 0.0625, 0.25, 1, and 4.
Answer
A g(x) = (0.25)
B g(x) = 256(0.25)
C92) = 0.0625(4)"
D g(x) = 0.5(4)"

Answers

The answer is c. I hope u get it right

Answer: C 92) = 0.0625(4)

Step-by-step explanation:

it iz

Can y’all plz help me

Answers

Answer:

D. 10

Step-by-step explanation:

Assuming that <COA is a right angle, we can say that the two given angles are complementary

complementary angles are angles that add up to 90 degrees

this means we can create this equation: 3x + 46 + 14 = 90

so subtract 46 and 14 from 90: 3x = 30

divide both sides by 3: x = 10

Answer:

I think that it is letter D

Step-by-step explanation:

sorry if im wrong. but i hope this helps! :)

Write a linear model for the amount of boxes, b, as a function of the number of hours since they opened, h. Use your model to predict the number of boxes in stock at the end of an 8 hour shift.

Answers

Question:

A company produces boxes of DVDs at a rate of 52 boxes per hour they begin to produce boxes when they first opened for the day and after 3 hours have 400 boxes in stock.

- How many boxes were in stock when they opened?

- Write a linear model for the amount of boxes, b, as a function of the number of hours since they opened, h.

- Use your model to predict the number of boxes in stock at the end of an 8 hour shift.

Answer:

1. [tex]Initial = 244[/tex]

2. [tex]b = 244 + 52h[/tex]

3. 660 boxes

Step-by-step explanation:

Given

[tex]Rate = 52\ per\ hour[/tex]

[tex]Total\ boxes\ in\ 3\ hours = 400[/tex]

Solving (a): Initial Number of boxes

First, we calculate the number of boxes made in 3 hours

[tex]Boxes = Rate * Hours[/tex]

[tex]Boxes = 52 * 3[/tex]

[tex]Boxes = 156[/tex]

If they had 400 boxes at the 3rd hour.

Then, the number of boxes when they opened is:

[tex]Initial = 400 - 156[/tex]

[tex]Initial = 244[/tex]

Solving (b): Linear function

[tex]b = boxes[/tex]

[tex]h = hours[/tex]

Since, we have the rate and the initial number of boxes.

The linear function is:

[tex]Boxes = Initial + Rate * Hours[/tex]

i.e.

[tex]b = 244 + 52 * h[/tex]

[tex]b = 244 + 52h[/tex]

Solving (c): Boxes at the end of the 8th hour

We have:

[tex]b = 244 + 52h[/tex]

In this case:

[tex]h = 8[/tex]

Substitute 8 for h

[tex]b = 244 + 52 * 8[/tex]

[tex]b = 244 + 416[/tex]

[tex]b = 660[/tex]

Hence, there are 660 boxes at the end of the 8th hour

Hello! :)
Please help me solve this + explain your answer :)

I will indeed give you Brainlst <3

Answers

The answer B makes the most sense out of all because s and b are congruent and that’s the only two there
The answer is b make sense


Which fraction is equal to 30%?
A.
30
100
B.
100
300
C.
100
30
D.
3.0
100

Answers

Answer:

A. 30/100

Step-by-step explanation:

All you have to do is divide the numerator by the denominator and then multiply that result with 100 like so:

(Numerator/Denominator)*100

When you enter 30/100 into the above formula, you get (30/100)*100 which calculates to:

30%

Good Luck!

Answer:

1. 30/100

Step-by-step explanation:

Convert fraction (ratio) 30 / 100 Answer: 30%

Ed spent 25% of his savings on lunch, which cost $5.25. How much did he have in savings before lunch?

Answers

Step-by-step explanation:

I think 21 dollars is the answer

Roberto wants to display 18 sports cards in an album. Some pages hold 2 cards and others hold 3 cards. How many different ways can Roberto display his figures?


Answers

Answer: The answer is 2.

HOPE IT HELPS!!

Other Questions
Escribe tu opinin en relacin al texto utilizando al menos dos conectores ? According to the author, which is Fenimore Cooper's greatest failing as a writer?1. He repeatedly uses the same contrivances.2. He lacks understanding of his subject.3. His titles are misleading and ambiguous.4. His heroes never prevail and are boring. hi please help with all 30 points!! There's something wrong with each of the following statements. Figure out what ItIs. Cross out parts of the sentence and make corrections on the line.1. Unlike the federal government, state governments only have one branch of goverment.2. States are divided into districts, and citizens in each district elect a governor to be head oftheir district.3. A state's executive branch includes many departments that handle thousands of smallissues such as misdemeanors.4. States can afford to provide citizens with all necessary services and do not usually need anyfinandal help.5 local governments are independent and have the power to do anything they want to. 667676767667676767676766676767676766767676766776767676767676767676767676767676767676 x 6676767676766767676767676767676767676767676767676767676767676767676676767676767676767 Take notes about this passage and identify the key words.The Declaration of Independence is a document that was signed by a group ofpeople in the New World who decided to split off from the King of England. Theywanted to become an independent country. These leaders wanted other peopleto respect them, and so the declaration was their explanation of why they weresplitting off from England. They believed: That all men are created equal That all men have some rights given to them by God That among these rights are life, liberty, and the pursuit of happiness.Among the men who signed this declaration of independence were BenjaminFranklin and Thomas Jefferson. WILL AWARD BRAINLIESTDescribe how Romeos mood changes over the course of Act One. Use details from the text to justify how he was at the beginning of Act One, and how he feels at the end. What is the cause for this change? Is (1, -7) a solution of y=x-8?Yes Please help me with these questions FAST it's formal and I can't faillllllll!!!!!!, If you had to define ecological succession in your own words in a 140 character text, how would you define it? Dominique's age is 4 years less than twice brother's age b. Dominique is 12 years old. How old is her brother? Write an equation and solve using the replacement set of (6,7,8) pleaseeeeeee helpppppppppp Do a Hybrid CrossFill out the Punnett Square below for this story:Mary has blue eyes (bb) and David has brown eyes (Bb), if David and Mary have four children what will their eye color be? Will all their children have the same eye color? Why or why not.Child 1: Child 2:Child 3: Child 4: Thirteen more than three times a number is 25. What can you infer about the schools educational and social goals, based on Doves experiences? help would be appreciated ** if you could explain thatd be cool but if not thats ok Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3