I WILL GIVE BRAINLIEST!! I WILL ALSO GIVE 20+ POINTS!! HELP ASAP, NO LINKS! <3

Tyrone's age is 2 years less than 4 times his younger sister's age. If his younger sister's age is b years, which of the following expressions best shows Tyrone's age?


A) 4b
B) b - 2
C) 2b - 4
D) 4b - 2

Answers

Answer 1
D.) 4b - 2 is the answer good luck!!
Answer 2

Answer:

D) 4b - 2 is the correct answer.

Step-by-step explanation:

2 years less than 4 times his younger sister's age

younger sister's age is b years

4b - 2

Have a nice day! :-)


Related Questions

A florist arranges some orchids in bouquets of 20 and some roses in bouquets of 10. She sells each orchid bouquet for $25 and each rose bouquet for $30. She earns a total of $390. If she sells four times as many orchid bouquets as rose bouquets, how many flowers does she sell altogether?

Answers

Answer:

270 flowers total she sell Together.

Step-by-step explanation:

According to the Question,

Given, A florist arranges some orchids in bouquets of 20 and some roses in bouquets of 10.

Let, x = number of orchid bunches & y = number of rose bunches.

Now, She sells each orchid bouquet for $25 and each rose bouquet for $30. She earns a total of $390

Therefore, 25x + 30y = 390 ⇒⇒ Equation 1  

she sells 4 times as many orchid bunches as rose bunches,

Therefore,  x = 4y  ⇒⇒ Equation 2

Put The Value Of Equation 2 in Equation 1, We get

25 × (4y) + 30y = 390  

100y + 30y = 390

130y = 390  ⇔ y = 390 / 130 ⇒ 3  

if y = 3, then x = 4y must be equal to x= 12.

Thus, she sold 12 orchid bunches and 3 rose bunches.

Verify, 25x + 30y = 390 ⇔ 12 × 25 + 3 × 30 = 390 (All okay)

Now, Each orchid bunch contains 20 flowers and each rose bunch contains 10 flowers.

12 × 20 + 3 × 10 = 240 + 30 ⇔ 270 flowers total she sell Together.

PLEASE help !! someone who knows fr ! pls

Answers

Answer:

It is the first option

Step-by-step explanation:

Which option is correct?

Answers

Answer:

Radius : 3 inches

Height : 2 inches

Step-by-step explanation:

[tex]π \times (radius {)}^{2} \times (height)[/tex]

[tex]π \times {3}^{2} \times 2[/tex]

[tex]π \times 9 \times 2[/tex]

[tex]9 \times π \times 2[/tex]

[tex]18\pi[/tex]

Hope it is helpful...

Anyone know how to do this?

Answers

Answer:  2 < x < 7

=======================================================

Explanation:

The 85 degree angle is smaller than the 90 degree angle (aka right angle). That must mean 5x-10 is smaller than 25

At the same time, 5x-10 must be larger than 0 to avoid having a 0 length or negative length.

So overall we can say 0 < 5x-10 < 25

-------------

Let's isolate x

0 < 5x-10 < 25

0+10 < 5x-10+10 < 25+10 ...... adding 10 to all sides

10 < 5x < 35

10/5 < 5x/5 < 35/5 .... dividing all sides by 5

2 < x < 7

This says that x is between 2 and 7, but we cannot have x equal either endpoint.

yeyeyeyeyeyeyetettetetettetetetettetettetetete

Solve the equation. 11 6 = n + 7 9 6 11 ​ =n+ 9 7 ​ start fraction, 11, divided by, 6, end fraction, equals, n, plus, start fraction, 7, divided by, 9, end fraction n = n=n, equals

Answers

Answer:

n = 19/18

Step-by-step explanation:

Given:

11/6 = n + 7/9

Find n

11/6 = n + 7/9

Subtract 7/9 from both sides of the equation

11/6 - 7/9 = n + 7/9 - 7/9

11/6 - 7/9 = n

(99-42) / 54 = n

n = 57/54

n = 19/18

Answer:

19/18

Step-by-step explanation:

Jo had $5 more than Nate and together
they had $43. How much did Nate have?

Answers

Answer:

$14

Step-by-step explanation:

Let Joe have $x

Then Nate would have $(x-5)

They both have $(x + (x-5)  which is equal to $43

                           $(x + x -5) = $43

                           $2x - $5 = $43

                            $2x = $(43 - 5)

                           $2x = $38

Divide both sides by $2

                               x = 19 (Joe has $19)

:. Nate has $(19 - 5) = $14.

                             

Nate have 24 dollars.

What is equation?

Equation is the defined as mathematical statements that have a minimum of two terms containing variables or numbers is equal

What are Arithmetic operations?

Arithmetic operations can also be specified by the subtract, divide, and multiply built-in functions.

The operator that perform arithmetic operation are called arithmetic operators .

Operators which let do basic mathematical calculation

+ Addition operation : Adds values on either side of the operator.

For example 4 + 2 = 6

- Subtraction operation : Subtracts right hand operand from left hand operand.

for example 4 -2 = 2

* Multiplication operation : Multiplies values on either side of the operator

For example 4*2 = 8

Suppose that Jo has x dollars of amount, and

Nate has y dollars of the amount

Given that Jo had $5 more than Nate and together they had $43

x + 5 = y  ,

x + y = 43,

Substitute the value of y in the equation x + y = 43,

x + 5 + x = 43

2x = 43 - 5

2x = 38

Divide both sides by 2

x = 19

Now substitute the value of y = 19 in the equation x = y +5,

So, y = 19 + 5

y = 24

Hence, Nate have 24 dollars.

Learn more about equation here:

brainly.com/question/10413253

#SPJ2

Select the correct answer.
Name Account Balance
Peyton $250.85
Cooper $65.00
Brendon $230.23
Gerald $58.55
The table shows the bank account balances of four friends. Which sentence about the balances is true?

A.
Gerald has more money in his account than Brendon does.
B.
Peyton has less money in her account than Gerald does.
C.
Cooper has more money in his account than Peyton does.
D.
Brendon has more money in his account than Cooper does.

Answers

Answer:

D. Brenden Has more money in his account than Cooper does

Using the graph as your guide, complete the following statement.
The discriminant of the function is A. zero
B. negative
C. positive

Answers

Answer:

Step-by-step explanation:

The discriminant tells you where the graph of the parabola goes through the x-axis, if at all. If the discriminant is negative there are no real zeros and the parabola does not cross or touch the x-axis; if the discriminant is positive the parabola will go through the x axis in 2 places; if the discriminant is 0 the parabola will touch the x-axis in 1 place. Our discriminant is 0 since the parabola only touches the x-axis but does not go through.

How to do these questions step by step

Answers

Answer:

Only for question 1

Step-by-step explanation:

The answer is

When numbers with indices are being multiplied together, the indices act as if its being added together whereas if you multiply the indices together then it would multiply them all

Representa en notación científica 0.00000345

Answers

Answer:

3.45×10^-6

Step-by-step explanation:

Crea el decimal usando los últimos 3 números: 3.45

Multiplica por 10 a la negativa potencia del número de ceros: 10^-6

On Saturday, the fruit and juice bar was selling 20 glasses of fruit punch an hour. By 7 p.m., they had sold 180 glasses. If their goal was to sell more than 240 glasses of fruit punch, find the number of hours, h, they must stay open past 7 p.m. to make their goal.

Answers

Answer: A)  h > 3

======================================================

Explanation:

h = number of hours past 7 pm

20h = the number of glasses sold after h hours

20h+180 = adding on the 180 glasses already sold

20h+180 > 240 is the inequality to set up

Let's solve for h

------------------

20h+180 > 240

20h > 240-180

20h > 60

h > 60/20

h > 3

They must remain open more than 3 hours past 7 pm in order to sell more than 240 glasses of juice.

The earliest that they can close is 11 pm (since 4+7 = 11).

--------------------

If h = 3, then

20h+180 = 20*3 + 180 = 240

meaning that they haven't reached their goal of getting over 240

So they have to stay open that extra hour to get past 240.

Draw the graph of y = 2x + 1

Answers

Hoped that I helped you :)

Answer:

Step-by-step explanation:

simplify 16^x+1 +20(4^2x)/2^x-3 8^x+2

Answers

the answer is in the attachment

Hope it helps

When you have a table, what is the easiest way to find
K?
x/y
y/x
x•y
x + y

Answers

Answer:

y/x

Step-by-step explanation:

When we do y/x we can find the value of k. It gives us the constant of variation.

Expand and simplify 4(2x-1)+3(2+5)

Answers

Answer:

8x + 17

Step-by-step explanation:

4(2x- 1) + 3(2 + 5)

=4*2x - 4*1 + 3*7

=8x - 4 +21

=8x + 17

What is the value of x?

Answers

Answer:

29

Step-by-step explanation:

The right triangle is isosceles triangle so we have the left angle of it is:

180-64=116

116÷2=58

Then start to calculate the left triangle angles:

180-58 = 122

180-122 = 58

58÷2 = 29

Find the fraction of Chandler's comic book collection that is made
up of both Arachna-Man and Wonderdog comics. Explain how
you found
your answer.

Answers

im not sure what your asking

An object is moving at a speed of 4 feet per mimite. Express this speed in miles per week. Round your answer to the nearest hundredth​

Answers

Answer:

7.64 miles/week

Step-by-step explanation:

there are 5280 feet in a mile

and 10080 minutes in a week

so it's

4 * 10080 / 5280

the two big numbers where just gougled

Answer:

7.64 miles/week

Step-by-step explanation:

1 mile = 5280 feet ⇒ 1 foot = 1/5280 of a mile1 week = 10080 minutes ⇒ 1 minute = 1/10080 of a week

4 feet / minute = 4* 1/5280 miles ÷ 1/10080 week = 10080/1320 miles/week =  7.64 miles/week (rounded)

HELP pleaseee..!!!!!!!!!!!!!

Answers

Answer:

a) 9yd

b) 12ft

Step-by-step explanation:

a) find the square root

b) divide 48 by 4

Sophie and Simon are peeling a pile of potatoes for lunch in the cafeteria. Sophie can peel all the potatoes by herself in 45 minutes, while it would take Simon 30 minutes to do the job working alone. If Sophie and Simon work together to peel the potatoes, how long will it take them?

A table showing Rate in part per minute, Time in minutes, and Part of Potatoes Peeled. The first row shows Simon and has StartFraction 1 Over 30 EndFraction, t, and t times StartFraction 1 Over 30 EndFraction. The second row shows Sophie, and has StartFraction 1 Over 45 EndFraction, t, and t times StartFraction 1 Over 45 EndFraction.

15 minutes
18 minutes
38 minutes
75 minutes

Answers

Answer:

the answer is 38 minutes

Answer:

18

Step-by-step explanation:

The base of a triangle is twice the height of the triangle.
The area of a triangle is 16 cm.
Draw the triangle on a centimetre grid.
(2 marks)

Answers

Answer:

4cm

Step-by-step explanation:

[tex]area = \frac{1}{2} \times base \times height \\ 16 {cm}^{2} = \frac{1}{2} \times 2x \times x \\ 16 {cm}^{2} = \frac{2 {x}^{2} }{2} \\ \\ 16 {cm}^{2} \times 2 = 2 {x}^{2} \\ 32 {cm}^{2} = 2 {x}^{2} \\ \frac{32 {cm}^{2} }{2} = {x}^{2} \\ 16 {cm}^{2} = {x}^{2} \\ \sqrt{16 {cm}^{2} } = \sqrt{ {x}^{2} } \\ 4cm = x \\ [/tex]

Pls help me I don’t understand this!!!!

Answers

Answer: D

Step-by-step explanation:

D The angle agacent to arc ML is half the degree. Your answer is 118

Answer:

D

Step-by-step explanation:

angle J is a circumference angle that insists on arc ML. the measure the angle  of this arc is double of it

59 * 2 = 118 degrees

What is the solution to this equation?
X-7 = 18
A. X= 25
B. X = 35
c. x = 9
D. X= 1)​

Answers

Answer:

x = 25

Step-by-step explanation:

X-7 = 18

Add 7 to each side

X-7+7 = 18+7

x = 25

Given that,

X-7 = 18

Now we can add 7 to each side,

→ X-7 + 7 = 18+7

→ x = 25

So, option (A) is the correct answer.

PLEASE HELP. !!!!!!!!!

Answers

Answer:

(-1,8)

Step-by-step explanation:

use formula

A(x,y) = A'(-y , -x)

coordinate point is

(-8,1)=(-1,8)

therefore the image of the (-8,1) after a reflection over the line y=-x is (-1,8)

Answer:

A'(-1,8)

Step-by-step explanation:

Initial point A(-8,1)

reflection about y=-x has the rule

x, y -> (-y, -x)

So

A(-8,1) -> A'(-1,8)

Square ABCD has an area of 1600. E is the midpoint of AC and Fis the midpoint of AB.
What is the area of the trapezoid BCEF?
O 300 square units
O 1,200 square units
O 600 square units
O 109 square units

Answers

B……….. thank me later.

Can predictions be made of a scatterplot that shows no association? Explain your answer.

Answers

Answer:

There is no relationship between the variables.

There is no pattern between the variables.

No reliable predictions are possible.

Step-by-step explanation:

this is the exact answer on edge 2021

Answer:

No, because no association means there is no relationship between the variables. So there is no pattern that results in reliable predictions.

Step-by-step explanation:

its the sample response

Write the most appropriate preposition in the blank. Use one word only once.

above, beneath, after, ahead of, during, beyond, across, against, before, upon, around

1. I was bored _________________ the whole film.
2. He lives in the house __________________ the street. It’s nearly opposite mine.
3. Nipuna is _________________ Kalana in the race. Nipuna will win.
4. Did you vote for or __________________ the suggestion?
5. Running _____________ the class, the student abruptly faced the class teacher at the door.
6. There are no dinosaurs ____________________ Earth now.
7. They live in the hills, 1000 metres ____________________ the sea- level.
8. We had our lunch _____________________ the meeting.
9. Never forget to wash your hands _____________________ meals.
10. The tunnel runs _____________________ the sea.

Answers

During,around,ahead of,against,
1. During
2.Across
3. Ahead of
4. Against
5. Around
6. Upon
7. Above
8. After
9. Before
10. Beneath



Measurement and Geometry
11. What would the total interior angles be for a 21 sided shape?

Answers

Answer:

sum_of_interior_angles = (number_of_sides - 2) x 180° → if number_of_sides is 21: sum = (21 - 2) x 180° = 19 x 180° = 3420°

Step-by-step explanation:

Answer: 3420 degrees

Explanation: You use the formula 180(n-2) with n = 21 to find the answer above.

How far is the bottom of the ladder from the base of the building, in feet?

A: 4 ft
B: 16 ft
C: 32 ft
D: 45 ft

Answers

Answer: 16ft

Explanation: Use the pythagorean theorem (a^2+b^2=c^2) to plug in values and find the missing leg!

can someone please help

Answers

Answer:

Concurrent as my perception

Other Questions
If he jumps from the plane with a velocity of +2 ft/s and, after 7 seconds of free fall, he has a velocity of -223ft/s, what is his displacement? Albino Moth - Unknown Allell is listed here. Transcribe it into mRNA andthen translate it into amino acids using the codon table. You only need topost the amino acids. DNA - TGG GGT AAG GAC GAG CGC ATC CAGAGPheUUUUUC)UUAUUGCysUGUUGCUGAUAUUAC)TyUAAStopSerLeuStopUGGTrpUCUUCCUCAUCGCCUCCACCGUAG)CAUTCAC)CUUCUCCUACUGHisLeuProCGUCGCCGACGGArgCAACAG)AAUGinlleSerAUUAUCAUAAUGACUACCACAACGThrAAC) AsnAGUAGC)AGAAGG)Met 13GAUArgGUUGUCValGCUGCCGCAGCGAlaGAC} AspGGUGGCGGAGGGGlyGUAGAAGAGGluGUG If two opposing forces are equal, then the net force is 0 N.true or false? Which is a quadratic function?A y = X-9B y = x +9C y = x + 2x -9 Describe how a jump rope can be used to model a cell membrane of a plant cell what is the value of x to the nearest tenth? NEED HELP!! Edmentum PLATO 50 POINTS! Marketing through social media is very popular today. You have seen how mobile technology has accelerated the use of social media for marketing.Research at least three mobile marketing techniques and then write a report about a company that has used mobile marketing with success. Include the following points in your report: Describe in detail the technique used in the mobile marketing campaign.What was the campaign trying to achieve?Who was the target audience? What techniques did the company use to broaden the audience base?Describe the campaign process in detail.What results did the campaign achieve?How did mobile technology play a key role in the marketing campaign?How did mobile technology enhance the campaign compared to traditional marketing methods?Why do you think the campaign succeeded?In what ways could the company have improved the campaign? What was Darwins conclusion about the shells in Santiago True power can only be measured across what? malaria is caused by 9. I can't talk to you rightnow. Because I ___________. A) am study B) are studying C) am studying D) is studying 10. I hate ___________ money from other people. A) to borrow B) borrow C) borrowing D) having borrowed 11. A country is _____ than a city. A) cheap B) cheaper C) cheapest D) more cheaper 12. What___________ the cat doing over there by the chair? A) is B) are C) does D) do 13. At last I have discovered how___________ the door. A) to be opened B) opening C) to opening D) to open 14. A city is _____ than the country. A) the most exciting B) exciting C) more exciting D) excited 5) A retailer bought a bag for $80 and sold it for $120. Calculate the percentage profit. * what are the three stages of aerobic cellular respiration?A.electron transport chain, assimilation, fermentationB.glycolysis, Krebs cycle, electrons transport chainC.glycolysis, phosphorylation, photosynthesis D.krebs cycle, fermentation, assimilation How did Madison propose to improve the economy in the United States? what is the value of a? what is the a value of the vertex form...y = (x - 3 )^2 - 36 What were the pros and cons of Caesar crossing the Rubicon River? What value of x will make the triangles similar by theSSS similarity theorem? PLEASE HELP WILL MARK IF YOU HELP!! Using the information below, calculate net income for the period: Sales revenues for the period $1,323,000 Operating expenses for the period 258,000 Finished Goods Inventory, January 1 55,000 Finished Goods Inventory, December 31 60,000 Cost of goods manufactured for the period 559,000A. $774,000.B. $769,000.C. $530,000.D. $535,000.E. $448,000.