If sum of the 20 deviations from the mean is 100, then find the mean deviation.​

Answers

Answer 1

Answer:

The mean deviation is 5

Explanation:

n=20

n=20∑x=100

n=20∑x=100xˉ=∑x/n =100/20=5

hope it helps you!!!

have a great day sis ^_^

Answer 2

Answer:

The mean deviation is 5

Explanation:

n=20

n=20∑x=100

n=20∑x=100xˉ=∑x/n =100/20=5


Related Questions

En la oración 5 del párrafo 4, ¿qué significa la expresión de la narradora “lo hace a los cuatro vientos”?
A. Que el tomate se extiende mucho
B. Que el viento hace caer los tomates
C. Que su madre habla constantemente
D. Que hay que proteger las ramas del viento

Answers

Answer:

A. Que el tomate se extiende mucho

Explanation:

A. Que el tomate se extiende mucho

Cuando la narradora dice "lo hace a los cuatro vientos", significa que el tomate se extiende mucho.

"Hacer a los cuatro vientos" es una expresión de origen muy antiguo que se refiere a la rosa de los vientos, consistente en cuatro direcciones fundamentales: Septentrión (Norte), Meridión (Sur), Poniente u Occidente (Oeste), Levante o Oriente (Este).

En un sentido figurado, este término significa que algo se derrama, desparrama, extiende o difunde en todas direcciones. El viento es una expresión figurada para punto cardinal.

Por tanto, cuando la narradora dice "lo hace a los cuatro vientos", significa que el tomate se extiende mucho.

Invitamos cordialmente a ver esta pregunta sobre la rosa de los vientos: https://brainly.com/question/24642598



PLEASE TELL ME WHAT THE NUMBERS ARE!!


Yo sólo _12_(tener) catorce años y _13__ (estar) en la escuela secundaria.
__14_ (ser) petisa y ____15__ (tener) pelo largo. Todos los días __16__ (caminar)
a la escuela. Allí ___17_ (estudiar) matemáticas y ciencias. Yo amo la clase de
inglés, pero la clase de español ___18__(ser) muy difícil para mí. Generalmente,
cuando yo _19__(hablar) mis compañeros se ríen de mí porque ellos dicen que yo
uso un acento raro. Pero cuando yo no _20__ (comprender) algo, siempre _21_
(levantar) mi mano para preguntar a la maestra. Me _22_ (gustar) mucho la
escuela.

Answers

Answer:

1. doce

2. trece

3. catorce

4. quince

5. dieciséis

6. diecisiete

7. Dieciocho

8. diecinueve

9. veinte

10. veintiuno

11. Veintidós

Explanation:

There in order.

Explanation:

My name is Julio, and I live in Tegucigalpa, Honduras. My dad's side of the family is Puerto Rican and Cuban, while my mom's side of the family is Portuguese. My friend Petra lives in Florida, United States, and her dad's family is African and Cuban, while her mom's side of the family is Cuban and French.

What is similar about Julio and Petra's heritage? (1 point)
They both have Cuban ancestry.
They both have French ancestry.
They both have Italian ancestry.
They both have Portuguese ancestry.

Answers

Answer:

They both have Cuban ancestry.

Explanation:

Answer:

they both have cuban ancestry

Explanation:

julios dad side is cuban and petra her dads and moms family is cuban

I will brainliest for a right anwer​

Answers

Answer:

están comprandoestamos comiendo están viviendo están almorzandoesta escribiendoestoy corriendoestamos aprendiendoestoy leyendoestán hablandoestán abriendo

Explanation: Hope they are correct and you mark me brainliest

A)Choose and write the indirect object pronoun the best fits the sentence.
1) A nosotros gusta practicar deportes.(les/nos)
2)A mi padre gusta estar en casa. (le/les)
3)A .. gusta mucho usar la computadora. (te/me)
4) ¿A ustedes gusta correr en el parque? (les/nos)
5)A mi
gusta ir de compras. (te/me)
B)Use the right form of the verb "llevar" to complete the sentences.
1) Maria una vestido amarillo muy bonito.
2) Yo a la escuela el uniforme de sexto grado.
3)Carlota y yo pantalones cortos al juego de futbol.
4) Y tú, ¿ Que alla fiesta de tus amigos?

Answers

Answer: 1- nos

2- le

3- I don’t understand this I think a word is missing

4- les

5- me

B-

1- Maria va a llevar un vestido amarillo muy bonito.

2) Yo voy a llevar a la escuela el uniforme de sexto grado.

3)Carlota y yo vamos a llevar pantalones cortos al juego de futbol.

4) Y tú, ¿ Que vas a llevar a la fiesta de tus amigos?

Escoge.
La noticiera que está presentando las noticias ahora es muy______.
Hace muchos años que trabaja para esta_____ y el público la adora.

A)acomodada, colonia
B)titular, estación
C)ojeada, revista
D)ilustre, emisora

Answers

Correct answer is D: ilustre, emisora
La respuesta correcta es la D

You went to the mall. What mode of transportation did you use to get there? How did you pay for things you are buying? What did you do there (watch a movie, eat something, etc)? If you want clothing vocabulary, look at Unit 2 of 1B. Minimum of 5-8 sentences.

Please answer in Spanish.

Answers

Answer:

Yo llegue manejando en mi carro. Yo pago todo lo que yo quiero con mi tarjeta de crédito. Yo guardo mi dinero y gasto la mitad para que no me lo gaste todo. Yo fui a comer tamales y fui a ver una película que yo siempre e soñado de ver. La película que vi yo, fue muy graciosa y divertida.

Answer:

Yo llegue manejando en mi carro. Yo pago todo lo que yo quiero con mi tarjeta de crédito. Yo guardo mi dinero y gasto la mitad para que no me lo gaste todo. Yo fui a comer tamales y fui a ver una película que yo siempre e soñado de ver. La película que vi yo, fue muy graciosa y divertida.

Explanation:

Llena el espacio con la conjugación correcta del verbo.

Tú ________ la información.
repetí
repitó
repetiste
repetió

Answers

Answer:

Repetiste

Explanation:

Tú ____repetiste____ la información.

...                                  

Third one “Repetiste”. Tú repetiste la información.

please write them in question form and translate.​

Answers

I hope this helps! I'm sorry if it's too simple

Qué tipo de oración es la siguiente si no vienen a casa entonces Nos encontramos en el teatro​

Answers

Answer:

Es una oración Exhortativa

Explanation:

Porque es como si estuvieras dando una orden osea es una oración positíva,dándole como dos opciones.

Answer:

Condicional

Explanation:

Es una oración condicional

En este caso:

Si  means if

Si es ocupado como condicional y no es usado como afirmación.

"Si" it is used as conditional and is not used as a afirmative

Write one sentence about your garden

Answers

Answer:

Mi jardín tiene el césped muy bonito, mi papá lo acaba de cortar, también tiene una flores muy bonitas y aromáticas que mi mamá se encarga de cuidarlas y regarlas regularmente cada fin de semana, también tiene una banca donde yo estudio tranquilamente todas las tardes. Es un lugar muy bonito y apacible.

Explanation:

Answer:

my garden is very pretty with lots of flowers

Explanation:

white flowers

(Conjugate please)
Alberto le explica qué pasó cuando Daniel estaba en el partido de fútbol. Completa la conversación que tienen Alberto y Daniel con el verbo correcto y conjúgalo en el pretérito o el imperfecto, según el caso. Presta atención a los pronombres reflexivos también.

saber estar mirar silbar pasar meter

Daniel: Alberto, ¿Qué ______? No entiendo por qué todos los espectadores me _________ de repente con sus ojos tan intensos.

Alberto: Bueno, tú _________ muy fuerte y aquí en Colombia silbar no significa lo mismo que en Estados Unidos.

Daniel: ¡Ay, caramba! Yo no ________. El jugador número once __________ el gol de chiripa y yo _________ muy emocionado en el momento.

Answers

Answer:

Explanation:

Alberto: Bueno, tú _____ silbas ____ muy fuerte y aquí en Colombia silbar no significa lo mismo que en Estados Unidos.

Daniel: ¡Ay, caramba! Yo no _ silbé _. El jugador número once __ metió __ el gol de chiripa y yo ___ estuve ______ muy emocionado en el momento.

Read and choose the option that best answers the question.

Hi, I'm Maarit, and welcome to Xcanatun, my favorite city in Mexico. For a small town, Xcanatun has an amazing history that goes back thousands of years.

The walls of my house are made from stones that were found in the area. They were once used by an ancient Maya tribe to build their beautiful temples and carvings. Through these stones, I feel connected to my remarkable ancestors.

My family tends animals and farms the land. We grow sweet potatoes, corn, beans, chilies, and squash, just as our Maya ancestors have been doing for thousands of years.

Based on the text, what is true?

Her family is deeply religious.
Her relatives are skilled masons.
Their livelihood depends on agriculture.
They make a living out of only plants and crops.

Answers

Answer:

They make a living out of only plants and crops

Explanation:

I hope this helps!

14. Yo necesito una calculadora. ¿Qué necesitas
? *
O a. ustedes
O b. vosotros
O c. tú
O d. usted

Answers

Answer:

C

Explanation:

“yo necesito” tú necesitas. Respuesta: c “tú” ‍♀️

Help Please!! THIS HAS BEEN MISSING FOR 3 WEEKS!!

Answers

Answer:

Ok so the first row is canto cantas canta cantamos cantan

Second is preguntar, preguntas, pregunta, preguntamos, preguntan

third is contestar contesto, contesta, contestamos, contestan

4th is practicar, practico, practicas, practicamos, practican

5th is desear, deseo, deseas, desean

6th is llevar, llevo, llevas, lleva, llevamos

Explanation:

Ok so with AR verbs the conjugation for then is

O-as-a-amos-áis(vosotros form) an. If u look at number one u see the AR on the end of the verb for the conjugating you would remove the ar and add the conjugation for that subject. So its cantar so it would be canto-yo cantas-tu

canta-ust, el, ella -cantamos-nosotros and cantan-ustedes, ellos, ellas

I hope this help.

Ayer ________ mucho sol en mi ciudad.

Answers

Answer:

Hizo

Explanation:

Answer:

Hizo

Explanation:

Ayer ____ hizo ____ mucho sol en mi ciudad

¿Cuál oración es correcta?
A. Susana es más alto que Bernardo.
B. Susana es más alta de Bernardo.
C. Susana es más alta que Bernardo.

Answers

Answer: C) Susana es más alta que Bernardo.

Answer:

C: Susana es más alta que Bernardo.

Explanation:

Hacer tarea cada día/ usted

Answers

Answer:

Usted hace la tarea cada día.

Explanation:

Usted hace la tarea cada día.

Please help me I need this

Answers

Answer:

las cortala cocinolos lavalo compranlas mezcla

Explanation:

por que creen que los problemas sociales afectan a toda la poblacion​

Answers

Answer:

porque hablan mal de otros en la forma que actúa o vestirá

please help need done soon

Answers

Answer:

1. la parada del autobus

2. el edificio

3. la iglesia

4. el puente

5. el rio

Explanation:

i speak fluent spanish lol

1) A las nueve y media está esperando el autobús
2) A las diez y punto está hablando con el agente de viajes en su oficina
3) A la una esta asistiendo a una boda
4) A las dos y punto está cruzando el rio
5) A las cinco y punto está mirando la ciudad desde una lancha

lugar almorzar) al tenis
11. Mañana comienzo a
mi escuela.
O Juego
O almuerzo
O jugar

Answers

Almuerzo porque tiene que comer antes de ir al la escuela
Almuerzo! Thx and have a great day

You work as a manager at a local hotel. A new employee has a lot of questions. Respond to his questions using the correct form of the formal command.

1)Estos clientes quieren ir al centro de la ciudad, ¿llamo un taxi?
No, no ______Hay taxis en la puerta del hotel.

2)Hay un grupo nuevo de clientes, ¿les ayudo con el equipaje?
Sí, _____ por favor.

3)Los señores de la habitación 105 quieren algo de comer, ¿les llevo el menú del restaurante?
No, no _____Tienen uno en la habitación.

4)La señora de la habitación 278 dice que su factura (bill) está mal, ¿la miro?
No, no ____Ya la miro yo.

5)La señora Martínez necesita una nueva llave, ¿se la hago?
Sí, _____ por favor.

Any help would nice!

Answers

Answer:

1) hable

2) ayudame

3) ya

4) lo lea

5) hace la

3
Select the correct answer.
Listen to the sentence
and select Betty's nationality.
A
mexicana
B. inglesa
C. argentina
D.
alemana

Answers

You have to list a picture or something with this question
There has to be an audio with this

Como azer una tortilla

Answers

Just tell him to get you done ☑️ homework will give you Brainly if he wants it for a little late tomorrow if you want to

¿Cuál es tu libro favorito? ¿Qué te gusta hacer?

Answers

Answer:

Mi libro favorita es harry potter. Me gusta ver la tele

Explanation:

summary of episode 6 El Cuarto Misterioso

Answers

Answer:

how im supose to know this can u leave us like a video or something?

Explanation:

¿Las autoridades
cómo te pueden ayudar?​

Answers

Answer:

Te pueden ayudar a encontrar objetos perdidos, a protegerte de robos...

Translate you are smarter than I into Spanish by filling in the missing letters

Answers

Answer:

Here:

Explanation:

You are smarter than I; Eres mas lista que yo

Im confused about what you mean by filling in missing letters, can you clarify?

What that guy that answered previously is correct

Escribe. Tell Jairo what sport to play based on the sporting equipment he brought or
didn't bring to the park.
1. No tengo casco.
3. Tengo un bate
5. No tengo un balón.
2. Tengo una raqueta.
4. Tengo una pelota.
6. No tengo una bola.
1. Si no tienes casco, Juego al baloncesto!
2.
3.
4
5
6

Answers

Answer:

tengo un bate: Juega BéisbolNo tengo un balón: Juega i don't know any sport dont need a balltengo una raqueta: Juega TenisTengo una pelota: Juega futbolNo tengo una bola: the same as 2

Explanation:

I don't understand why they say that Balón was different than Pelota or Bola. IT'S THE SAME THING my first lenguage is spanish

2. Tengo una raqueta—juega tenis
3. Tengo un bate—juega beisbol
4. Tengo una pelota—juega fútbol
5. No tengo un balón—has natación
6. No tengo una bola—has ciclismo
Other Questions
__C+_SO2_CS2 + __CO Which ecosystem would be affected the most by losing its butterflies, and why? A. Ecosystem 2 because it has more kinds of plants, animals, and insects. B. Ecosystem 1 because it has more plants that depend on the butterfly. C. Ecosystem 2 because it has more insects that compete with the butterfly. D. Ecosystem 1 because it has fewer kinds of plants, animals, and insects. 15% of 20 is ??? please helpp What is the distance between (3,7) and (-3,-1) ? 1) How many organs of central government are there? Name them A uniform electric field exists in a region between two oppositely charged plates. An electron is released from rest at the surface of the negatively charged plate and strikes the surface of the opposite plate, 2.0 cm away, in a time 1.5 x 10-8 s. The speed of the electron in millions m/sec as it strikes the second plate is: A. 13.3 B. 133 C. 2.67 D. 26.7 E. 534 In the late1890s, who created a support system to help African American businesses? Jim Crow Pat McCrory W.C. Coleman A.M. Waddell Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= May someone help me with this :) Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Arrange the following steps to explain the process of protein synthesis inside the eukaryotic cell. Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7