In a paragraph, evaluate how well the rest of the constitution reflects Natural rights.

Answers

Answer 1

Answer:

 There are four ways that popular sovereignty is expressed in a democracy.

First, the people are involved either directly or through their representatives in the making of a constitution.

Second, the constitution made in the name of the people is ratified by a majority vote of the people or by representatives elected by the people.

Third, the people are involved directly or indirectly in proposing and ratifying amendments to their constitution.

Fourth, the people indicate support for their government when they vote in public elections, uphold the constitution and basic principles of their government, and work to influence public policy decisions and otherwise prompt their representatives in government to be accountable to them.

Explanation:


Related Questions

How did President Bush try to solve the nation's debt problem?
O by threatening to shut down the government
O by cutting government expenses and raising taxes
O by lowering taxes and decreasing government spending
O by increasing government spending on education and infrastructure

Answers

Answer:

by cutting government expenses and raising taxes

Answer:

B

Explanation:

who was there when the two party systems came

Answers

Answer:

Toward the end of the First Party System, the Republicans dominated a one-party system (primarily under the Presidency of James Monroe). Under the Second Party System, the Democratic-Republican Party split during the election of 1824 into Adams' Men and Jackson's Men.

Explanation:

On what grounds did Thomas Jefferson and James Adams oppose the Alien and Sedition Acts signed into law by John Adams

Answers

Answer:

It gave too much power to the federal government

Explanation:

Thomas Jefferson and James Adams protested against the Alien and Sedition Acts signed by John Adams because they believed it controlled too much power when it came to issuing law in states. Thomas Jefferson and James Adams were not in favour of allowing the powers to be in the hands of the federal government. Madison and Jefferson directed their opposition to the new laws to state legislatures.

explain your overall understanding of the Vietnam War and the sacrifices of those who served during the war?

Answers

Vietnam War, (1954–75), a protracted conflict that pitted the communist government of North Vietnam and its allies in South Vietnam, known as the Viet Cong, against the government of South Vietnam and its principal ally, the United States. Called the “American War” in Vietnam (or, in full, the “War Against the Americans to Save the Nation”the war was also part of a larger regional conflict and a manifestation of the Cold War between the United States and the Soviet Union and their respective allies.

The fall of which territory led to defeat of France in North America

Answers

Answer:

hope its help you

1ST:- QUEBEC AND MONTREAL

Btw on accident I clicked that but I also KINDA think it is that one but not sure can anyone help pls!

Answers

Answer:

C. It’s leaders conquering small kingdoms across India

Explanation:

The Mauryan Empire was located in two present-day eastern India. It lasted from 321 to 185 BCE. It was named after its founder Chandragupta Maurya, which started after the death of Alexander the Great.

The Mauryan Empire grew through its leaders conquering small kingdoms across India, starting from overpowering Nanda Dynasty then expanding eastward.

Hence, in this case, the correct answer is Option C.

Match each member of Congress to the correct description.

Answers

HERE IS UR ANSWER MATE!

DANIEL WEBSTERHENRY CLAYJOHN C. CALHOUN!...

HOPE U GOT CORRECT ANSWER MATE

The order of correct answers of the Political Leaders are:

Daniel WebsterHenry ClayJohn C. Calhoun

A lawyer from South Carolina; joined the US House of Representatives in 1810; worked toward improving national defense and states' rights - Daniel Webster.A congressman from New Hampshire and Massachusetts; introduced new tariffs, improved national transportation, and supported the national bank - Henry Clay.A lawyer from Kentucky; was appointed a senator in 1806; was a strong supporter of the War of 1812; encouraged westward expansion and improved transportation - John C. Calhoun.

Therefore, the correct answers are:

Daniel WebsterHenry ClayJohn C. Calhoun.

Learn more about Political Leaders here,

https://brainly.com/question/13669600

#SPJ2

48:36
Which term describes a "lightning war" that uses a combination of air attacks and fast-moving ground forces to
win a quick victory?
O blitzkrieg
O appeasement
O fascism
O arsenal

Answers

Answer:

A. Blitzkrieg

Explanation:

This infamous tactic had been used in the early stages of the German War Effort. It had been first used in Poland and France which shocked the global community due to its intense speed of invasion.

Reference:

Blitz: Lighting Krieg: War

The tactic was originally called The War of Movement.

Answer:

I think the answer is A but not 100% positive more like 99.2% :)(

What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?


Children enjoy the art displays of sea creatures.

Many people now look for trash to pick up when they are visiting the beach.

Creating artwork can be both beautiful and horrifying.

Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.
Question 2
Part B

Which detail from the text best conveys the answer in Part A?


"'It's the only thing he's liked all day,' his grandmother said."

"An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art."

"All of the art is made from plastic trash that washed ashore, including a great white shark…"

"She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas."

Answers

A passage open have different message. The answers are below.

The central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message is that  there was an Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.

The detail from the text best conveys the answer in Part A is that "She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas."

In any article, the stated main idea is often known as the thesis statement. But when the author does not state the main idea in a straight forward terms, then it can be called implied main idea.

Learn more about Central idea from

https://brainly.com/question/2684713

Answer:

The central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message is that  there was an Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.

Explanation:

What does the term “old walking city” refer to?

Answers

Answer: It refers to Urban Core

1. Describe the characters in this scene. What are they doing? 2. What does Janie's best friend think of the situation? 3 Why do you think Hurston wishes to convey by having her characters use dialect?

Answers

Answer:

1. The characters are Janie's female neighbors who are discussing the return of Janie without her friend, Teacake.

2. She defends Janie by highlighting that nobody truly knew the situation of things since Janie has not spoken about it.

3. Hurston wishes to convey the idea of community living among people who have similar customs, and traditions.

Explanation:

As Janie returns and goes to her house without her friend, her neighbors expect an explanation for the absence of Janie's friend but were met with no explanation. This was not the norm in their culture so they talked about it with wonder.

Janie's friend, Pheoby Watson made an excuse for the situation by explaining to the others that perhaps, Janie had nothing to tell them.

What were some of the psychological affects on the American soldiers who served in Vietnam?

Answers

The Vietnam conflict is conventionally regarded as a watershed in our understanding of the psychological effects of trauma. In particular, it led to the introduction of a new diagnosis in psychiatry, post traumatic stress disorder (PTSD), and also to a new epidemic of disturbed, violent and neglected service personnel



Enough i think?

What musical selection is played by the United States Marines Band at the beginning of the swearing in ceremony at the inauguration?​

Answers

Answer: Fanfare on Amazing Grace, God Bless America, and more

Explanation:

make a short letter saying goodbye to 2020​

Answers

Dear 2020,

I would have to say 2020 has been a rollercoaster for everyone and not only myself.

We've had some really really really bad times, but how 2020 played out gave "hard times" a different meaning.

Although 2020 wasn't the best, we fought on and as hard as we could even if it didn't seem like people weren't doing much while sitting at home or wearing masks or listening to the chaos on TV.

We were doing the most we could and helping others lives by staying home.

We are heros for that, and fighters and we continue to fight past these blocks of problems.

but now all things must come to an end and we're all hoping for a better year in 2021.

Goodbye 2020.

What groups were not given freedoms and rights in the Constitution? PLEASE answer this in few sentences explaining
THANK YOU!​

Answers

Answer:

Women were second-class citizens, essentially the property of their husbands, unable even to vote until 1920, when the 19th Amendment was passed and ratified. Native Americans were entirely outside the constitutional system, defined as an alien people in their own land.

Which of the following is the BEST clue to the theme of a
story?

Answers

The correct answer would be how characters respond to the main problem in the story.

It’s clear that they solve a problem in most stories, thus making it a theme to that particular story.

How did the admission of territories acquired by the U.S. in the Mexican War shed light on the root issues dividing north and south for decades before the Civil War

Answers

Answer:

By using propaganda

Explanation:

The admission of territories acquired by the U.S. in the Mexican War shed light on the root issues dividing north and south for decades before the Civil War By using propaganda.

What is a Civil War?

A civil war in the United States, or American Civil War. The Crown and the Rebellion, both which was made up of seceding states, engaged in combat. One side's objective may be to seize power in the nation or a specific area, secure regional independence, perhaps alter governmental practices.

In exchange for $15 million and even the insinuation of Mexico's citizens' statements by the U.S., Mexico agreed to cede to the United States and almost all or most of the territory that is now part of the states of Guatemala, Utah, Colorado, Arizona, San diego, Texas, or rather western Colorado. This agreement was later formally adopted both by nationwide congresses.

Learn more about Civil War, Here:

https://brainly.com/question/11874600

#SPJ5

Should the US have entered WWI? Why or why not?

Answers

Answer:

please give brainliest

Explanation:

yes because we didn't want to look like we could be pushed around

helppppppppppppppppppppppppppppp








Which outcome was the purpose of the 19th Amendment?

giving women the right to vote


establishing free public education


repealing Prohibition


granting suffrage to people over the age of 19

Answers

Answer:

Giving women the right to vote!

Explanation:

giving the women the right to vote

At least how many African nations gained thelr independence after World War II?

42
48
35
50

Answers

At least 50. Ethiopia was the only country that was not a colony.

I WILL GIVE BRAINLIEST!!! HELP

Answers

Answer:

1,2,3,4, & 5,

Explanation:

Kristen cut her hand on a piece of broken glass. Which piece of lab equipment would help her the most? a fire extinguisher O a blanket a first-aid kit a disposal container
help me please ​

Answers

Answer:

First-aid kit

Explanation:

Answer:

A first-aid kit

Explanation:

What country did Japan invade in the l930s?

Answers

Answer:

China

Explanation:

Answer:

The country that Japan invaded in the 1930's was Germany.

Explanation:

is a cucumber a fruit or vegatable



for a project

Answers

Answer:

a cucumber is a fruit

Explanation:

cucumber is a fruit cause they grow from the flowers of the plant and hold the seeds

Which action best explains
the differences shown in
these photographs? Choose
your answerand explain
why you chose it

A The United States gave
economic assistance
through the Marshall Plan

B The United States and the
Soviet Union created an
alliance after World War II

C The United Nations was
created after World War IL

D The Soviet Union
created the Iron Curtain
after World War II​

Answers

The action best explains the differences shown in these photographs is The United States gave economic assistance through the Marshall Plan. Thus the correct option is A.

What is a photograph?

A photograph refers to an image that represents beauty or anything that can be captured by using the camera in order to store it as memory. The given photograph is captured during the world war describes two different images of the French steel plant.

The first photograph shows the destruction that the place named as French steel plant is destructed by external or unknown forces In the year 1945. In another image, a similar french steel plant is renovated after three years that 1948.

As the french steel plant got damaged,  it is rebuilt by using the Marshall Plan which aims to provide economic assistance for the building which faced devastation after World War II.

Therefore, option A is appropriate.

Learn more about Marshall Plan, here:

https://brainly.com/question/22602380

#SPJ2

Please help this is due tomorrow. Whoever helps I’ll give them brainliest

Answers

Answer:

C. When the official falsely accuses a senator of breaking the law.

Explanation:

Use the table below to answer the question.
Ancient Civilization
Achievement
Sumerians
developed the first system of writing called "cuneiform”
created a set of laws called Hammurabi's Code
Babylonians
Assyrians
established one of the earliest libraries
Hebrews
practiced monotheism
Based on the information in the table, which civilization had the MOST influence on
Christianity?
A) Sumerians
B) Babylonians
C) Assyrians
D) Hebrews
Q
Question #13

Answers

Answer:

DDD

Explanation:

Which labor union had the greatest impact on the lives of workers

Answers

Answer:

The Knights

Explanation:

The Knights of Labor began as a secret society of tailors in Philadelphia in 1869. The organization grew slowly during the hard years of the 1870s, but worker militancy rose toward the end of the decade, especially after the great railroad strike of 1877, and the Knights’ membership rose with it.

your welcome

How did the invention of paper money help all dynasties?

Answers

It started in Tang but not until Song dynasty that it became institutionized as a governmental policy. It had two main advantages over money made out of silver, gold, copper or iron: It was easier to carry around and the copper and iron could be saved for use in everyday objects

How does the Bill of Rights ensure the basic rights and freedom of Americans?

Answers

Answer:

actually it dosent because you still can go to jail for something you didn't do and the system is still unfair ANSWER: the amendments, know as the bill of rights were designed to protect the basic rights of U.S. citizens, guaranteeing the freedom of speech, press, assembly, and excercises of religion; the right to fair legal procedures and to bear arms and that power not delegated to the federal government were reserved for the states

Explanation:

so even though the bill of rights are there some people with higher jobs take advantage of the rights

Other Questions
The Venn diagram below shows some of the services provided by national and state governments.Which service completes the Venn diagram? (3 points)A. Raise and collect taxesB. Declare war and make peaceC. Make marriage lawsD, Coin and print money I need a speech written about a president please put it down here Solve: 68 x = 14 ( please i really need these super fast thank you! ) Translate these sentences/words in Spanish please1.How are you2. I need to go to the store3. Mother4. Talkative 5. Its freezing to death in my house6. Online7. Go to the movies with a friend8. Charger Names and places in Spanish down below;9.Olive10.Walmart 11.School 12.Holly 13.Crystal i need help pleaseeescreen shot attatched happy new year. eeeeeeeee e Simplify 5(x - 2) - 3x + 7.A. 8x - 3B. -10x + 25C. 2x-5D. 2x - 3 I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? A duck walked up to a lemonade stand and he said to the man running the stand: Create a flow chart that shows the hierarchy of the US Banking Systems. which is the correct graph for the equation? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Bryan wants to buy a new pair of jeans. If the jeans were originally $45.00, but are on sale with a 20% discount, how much will Bryan have to pay for the jeans? MR. ARCEO TAKES A TAXI FROM THE AIRPORT TO A HOTEL. THE TAXI CHARGES $2.50 INITIAL CHARGE PLUS $2.65 PER MILE. WHICH EQUATION CAN BE USED TO FIND Y, THE TOTAL COST OF THE TRIP, IF X REPRESENTS THE NUMBER OF MILES OF THE TRIP?