In one paragraph, choose one southern European
country and state two reasons why its economy has
struggled. Then explain whether you think that country's
economy can improve in the future.

Answers

Answer 1
italy's economy historically struggled due to poor unification between regions, with sicily and venetia, for example, having incredibly different economies that are minimally connected. furthermore, children would usually work the same jobs as their parents, leading to low social mobility and occupations of new jobs. in the future, italy's economy can improve with better unification and public education. cooperation between different industries across regions would be highly beneficial.

Related Questions

who is Hugh Waddell.. please help​

Answers

Answer:

he was a major general during the french and indian war and supervised the building of fort dobbs

Answer:

Hugh Waddell was a colonial military and political official, merchant, and planter, was born in Lisburn, County Down, Ireland,

Explanation:

I hope this helps! Let me know if you need more info!

what is importation of expired drugs and foods and their effects​

Answers

Answer: Second life

Explanation:

The importation of the expired drugs and foods is called second life because a second life is given for the sale after the competition of the date of expiry. The date of expiry is the date after which something cannot be used the good s lose their quality.

Importation and consumption of expired drugs and foods have the following effects:

1. The person selling and importing the expired drugs and foods is liable to be prosecuted in the court of law.

2. The expired drugs and foods have undergone with change in chemical composition. The consumption of such drugs and foods may cause the growth of infecting bacteria in the body, develop antibiotic resistance and can cause serious illnesses.

Who was Muhamad? What was he responsible for?​

Answers

Answer:

Who was Muhammad? Muhammad was the founder of Islam and the proclaimer of the Qurʾān, Islam's sacred scripture. He spent his entire life in what is now the country of Saudi Arabia, from his birth about 570 CE in Mecca to his death in 632 in Medina.

HELPPPPP NOWWWW
Which of the following is a social condition type of social problem?
Drugs
Slavery
School violence
Alcoholism

Answers

Answer:

School violence is a social problem

Answer:

Slavery

Explanation:

Its social you do it with someone. And is abusive. It wouldn't be school violence because that's when the school is doing what they want.

Rural areas refer to _____.

Here’s the answer

Answers

Answer:

C. areas in the country

Have an amazing day :)

Explanation:

During World War I, the Nazis carried out the Holocaust-a program to murder Jews and other minorities.

Answers

Answer:

Yes, this is a true statement and also a very sad and tragic act of the tyranny of the Nazis

Explanation:

Sub to my you tube at

Pen Paper

Explain the difference between WWII and the Cold War.

Answers

Answer:

In the case of WWII, it was mostly fought between democracies (with the exception of the USSR) and fascist regimes. ... In WWII, there was a race between Nazi Germany and the United States to develop nuclear weapons. The Cold War also involved a nuclear arms race between the USSR and the United States.

hope this helps! :)

Explanation:

write a letter of gratitude and appreciation to the UAE government for its various initiatives that seek to foster tolerance and respect for human dignity among the UAE populace.

Answers

Answer:

The UAE has always been a model of tolerance and coexistence worldwide, set apart by values that promote openness, acceptance and respect for ethnic and religious diversity. With a deep commitment to safeguarding freedom of beliefs, the UAE renounces discrimination, hatred and racism. The country has also always extended a helping hand to those in need. Figures from the Organisation for Economic Cooperation and Development (OECD) show that UAE foreign aid amounted to $5.26 billion (Dh19.34 billion) in 2017 — support that was not tied to religion, race, gender or geographic location.

Set against this context, describing the UAE as merely a model of tolerance and coexistence falls short, especially when we look at its pioneering initiatives. The UAE has in fact emerged as a global capital of tolerance that sends messages of love and peace around the world. Led by the United Nations, the world marks November 16 every year as an International Day for Tolerance, but the UAE has declared the whole of 2019 as the Year of Tolerance.

Explanation:

Describe a human activity that could have caused the elk to disappear from Missouri. Then, describe a

human activity that could help bring the elk back to Missouri.

Answers

Answer:

McGeehan joined Conservation Department biologists wielding plywood shields as they herded the elk from the trailer and through a series of gates to sort them into holding pens. When he glanced up at Plattner, she teased “Why are your eyes so big, Chip?”

Explanation:

sorry i could not figure out the 2 part that says human activity could help bring the elk back to missori.

eating food what must be done before the action​

Answers

Answer:

washing your hands? if it's correct mark me brainliest :)

Explanation:

the early japanese religion or believed everything in nature has a spirit or kami

Answers

Answer:

Explanation:

Shinto (Japanese: 神道), also known as kami-no-michi, is a religion which originated in Japan. ... Shinto is polytheistic and revolves around the kami ("gods" or "spirits"), supernatural entities believed to inhabit all things.

Which best compares Henry Clay and Andrew Jackson?
Both Clay and Jackson belonged to the Democratic Party.
Both Clay and Jackson belonged to the Whig Party.
Both Clay and Jackson served in public office in the 1800s.
Both Clay and Jackson promoted the American System.

this is timed pls help now

Answers

A is correct, have a good day!

Answer: A

Explanation: I hope this helps

Which activity describes an application of topographic maps? Check all that apply.
O recreation, such as camping and hiking
Oengineering, such as the construction of roads and buildings
O science, such as mapping stars in the sky
Obusiness, such as analyzing population centers
Oscience, such as analyzing surface features

Answers

Answer: Edge 20-21

(1) recreation, such as camping and hiking

(2)engineering, such as the construction of roads and buildings

(5)science, such as analyzing surface features

Explanation:

Got it right

This ruling violated the recent
precedent set by Minersville v.
Gobitis. Are appellate courts supposed
to do that? If so, why didn't they?

Answers

Answer:

Maybe this will help

Explanation:

In a case later overruled by West Virginia State Board of Education v. Barnette (1943), the Supreme Court held in Minersville School District v. Gobitis, 310 U.S. 586 (1940), that state legislatures could require public school students to salute the U.S. flag and recite the Pledge of Allegiance without violating students’ speech and religious rights under the First and Fourteenth Amendments.Minersville students refused to salute the flag for religious reasons

Public school students in Minersville, Pennsylvania, were required to begin the school day by reciting the Pledge of Allegiance while saluting the flag. However, two students, Lillian and William Gobitas (a court clerk erroneously changed the family’s last name to Gobitis), refused. They claimed that such a practice violated their religious principles; they were members of Jehovah’s Witnesses, who believed that saluting the flag was tantamount to paying homage to a graven image. After the students were expelled from school, their father filed suit, claiming that his children were being denied a free education and challenging the required pledge. Both the district court and the court of appeals ruled that the required salute and pledge were unconstitutional.

Court upheld compulsory salute and pledge

In an 8-1 decision, the Supreme Court overruled the lower courts by upholding the compulsory salute and pledge. Writing for the Court, Justice Felix Frankfurter acknowledged that the First Amendment sought to avoid the “bitter religious struggles” of the past by prohibiting the establishment of a state religion and guaranteeing the free exercise of all religions. Yet the scope of this right to religious liberty could pose serious questions when, as in this case, individuals sought exemption from a generally applicable and constitutional law.

Citing a series of cases, beginning with the Court’s decision upholding anti-polygamy laws in Reynolds v. United States (1879), Frankfurter reaffirmed the principle that religious liberty had never included “exemption from doing what society thinks necessary for the promotion of some great common end, or from a penalty for conduct which appears dangerous to the general good.” In this case, the “great common end” was achieved through repetition of a “cohesive sentiment” represented by the salute and pledge to the flag, “the symbol of our national unity” that transcended all other differences.

Frankfurter defined the question in Gobitis as whether the Supreme Court could decide “the appropriateness of various means to evoke that unifying sentiment without which there can ultimately be no liberties, civil or religious,” or whether that decision should be left to the individual state legislatures and school districts. For Frankfurter and the majority of the Court, the decision obviously belonged to the legislatures and school boards. Although multiple methods were available for instilling “the common feeling for the common country” and some of those methods “may seem harsh and others no doubt are foolish,” it was for the legislatures and educators to decide, not the Court. The Constitution did not authorize the Supreme Court to become “the school board for the country.”

Stone said the compelled pledge should be unconstitutional

In his dissent, Justice Harlan Fiske Stone presaged the Court’s opinion three years later in West Virginia State Board of Education v. Barnette (1943) that would overrule the Gobitis decision. Conceding that constitutional guarantees of personal liberty are “not always absolutes,” Stone wrote that when legitimate conflicts arise between liberty and authority, the Court should seek “reasonable accommodation between them so as to preserve the essentials of both.” The Constitution did not indicate in any way that “compulsory expressions of loyalty play any . . .

state the duties faction and the responsibilities or the role of the three branches of the government

plss pa help naman po dito ​

Answers

Answer and Explanation:

The executive branch is responsible for the application of federal, state and local laws in society, as well as the application of repressive measures for those who disobey them. In summary, we can affirm that the executive power has as main responsibility the administration of the territory, proposing action plans, managing public interests and applying the laws. In addition, it is the responsibility of the executive to oversee legislative and judicial powers.

Legislative power is responsible, as its name already says, for legislating, that is, it is responsible for creating and approving the laws in force in the country. In addition, it is the responsibility of that governmental sphere to manage the administrative political and financial budgetary control of the region. It is also responsible for overseeing the judicial and executive powers.

The judiciary is responsible for interpreting the laws passed in the country and making judgments applying those laws to reach concrete conclusions on legal cases. In addition, it is responsible for overseeing the executive and legislative powers.

What famous words did Patrick Henry use in his speech about independence from Britain?

Give me liberty or give me death.
Give us your poor and your sick.
These are dark times.
We stand united!

Answers

Answer:

" I know not what course others may take,but as for me,give me liberty or give me death!"

Explanation:

hope this helps x

Answer:Give me liberty or give me death.

Explanation:

why is the proclamation of 1763 anger colonist​

Answers

The proclamation of 1763 angered the colonist because it didn’t allow them to cross pass the Appalachian mountains. Which they could not claim land legally past it too have a nice day (:

What was the main reason the First Anglo-Chinese war broke out?
A.
a struggle over the British sale of opium in China
B.
a struggle over control of Korea
C.
a struggle over control of Hong Kong
D.
a struggle for power between the nationalists and the communists


Please select the best answer from the choices provided

Answers

Answer:

D.

Explanation:

I took the test.

Answer:

its d besties :)

Explanation:

Pls pls hurry I have 6 minutes pls

Answers

Answer: answer would be D

Explanation:

Which Florida state government department is responsible for the care of children deemed wards of the court?
Select one:
A.
Department of Health

B.
Department of Children and Families

C.
Department of Community Affairs and Economic Opportunity

D.
Department of Education

Answers

Answer:

B

Explanation:

The passage sequences John Brown's raid Harpers Ferry.
What happened after Brown's army let the train pass?

Answers

Answer:

The girls prepared meals, washed clothes and kept nosy neighbors at a distance. Brown studied maps and conferred with John Cook, hid advance man in Harpers Ferry, about the town, armory operations, train schedules and any other information deemed valuable to his plan.

Explanation:

Sorry if I'm wrong.

According to the passage, most people who lived in rural areas had to travel into bigger towns and cities to get their mail. paid more for postage than people in bigger towns and cities. received their mail free of charge, like people in the cities. paid the postal service a hefty fee to make deliveries to their homes.

Answers

Answer: had to travel into bigger towns and cities to get their mail.

Explanation:

Answer:

Had to travel into bigger towns and cities to get their mail.

Explanation:

Just did it on Edge2021

in kenya most communites were rulled by​

Answers

big juicy ballsacks ok ok I want points don’t a me

Answer:

Daniel Arap Moi

why did the little rock nine happen

Answers

The Little Rock Nine were a group of nine black students who enrolled at formerly all-white Central High School in Little Rock, Arkansas, in September 1957. Their attendance at the school was a test of Brown v. Board of Education, a landmark 1954 Supreme Court ruling that declared segregation in public schools unconstitutional.

HELP 20 points to whoever gets this right

What should a thesis statement include?


a list of all the facts presented in the essay

key details from sources backed up with evidence

background about the topic and supporting details

the topic of the essay and an opinion about the topic

Answers

Answer:

A thesis statement should include key details from sources backed up with evidence.

Answer:

the topic of the essay and an opinion about the topic

Kings say the dream of America is “as yet unfulfilled.” Do his words still hold true today?

Answers

Answer:

yes, because the world has not seen it's end we can only assume this is just the beginning. Not only are we still developing technology but we are creating a new path for ourselves and others. His speech was about how differences don't matter or they shouldn't but as it quotes "We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable rights, that among these are life, liberty, and pursuit of happiness." This is the dream. The first things we notice in this dream is an amazing universalism. It does not say some men, but it says all men. It does not say all white men, but it says all men, which includes black men. It does not say all Gentiles, but it says all men, which includes Jews.  It does not say all Protestants, but it says all men, which includes Catholics.

Explanation:

hope this helps

A major failing of the United States Government under the Articles of Confederation was its

Answers

They did not charge taxes which was a major fail and they also could not raise a military and they could also not enforce laws

4. Explain two ways in which the Ka'aba is important in the Muslim Hajj (pilgrimage).
Refer to scripture or sacred writings in your answer. (5 marks)​

Answers

Sweet free points are hawt

Need someone to make me laugh I’ll mark brainlist

Answers

Hey wanna see something funny just look at a funny horse videos
21. A guy goes into a lawyer’s office and asks the lawyer: “Excuse me, how much do you charge?”

The lawyer responds: “I charge £1,000 to answer three questions.”

“Bloody hell – That’s a bit expensive isn’t it?”

“Yes. What’s your third question?”

Which statement is the best counterargument to the statement "Younger drivers are more likely to be involved in an accident”?

Teens are more likely to be distracted when driving.
The government has a responsibility to keep all drivers safe.
Teen drivers are three times more likely to be involved in a fatal crash than drivers over age 20.
People are less experienced drivers at age 18, so accidents will still occur.

Answers

Answer:

c

Explanation:

because reports of crashes have been around the ages of 18 year old drivers

Answer:

its d

Explanation:

the other person is wrong i took da test

Other Questions
667676767667676767676766676767676766767676766776767676767676767676767676767676767676 x 6676767676766767676767676767676767676767676767676767676767676767676676767676767676767 Take notes about this passage and identify the key words.The Declaration of Independence is a document that was signed by a group ofpeople in the New World who decided to split off from the King of England. Theywanted to become an independent country. These leaders wanted other peopleto respect them, and so the declaration was their explanation of why they weresplitting off from England. They believed: That all men are created equal That all men have some rights given to them by God That among these rights are life, liberty, and the pursuit of happiness.Among the men who signed this declaration of independence were BenjaminFranklin and Thomas Jefferson. WILL AWARD BRAINLIESTDescribe how Romeos mood changes over the course of Act One. Use details from the text to justify how he was at the beginning of Act One, and how he feels at the end. What is the cause for this change? Is (1, -7) a solution of y=x-8?Yes Please help me with these questions FAST it's formal and I can't faillllllll!!!!!!, If you had to define ecological succession in your own words in a 140 character text, how would you define it? Dominique's age is 4 years less than twice brother's age b. Dominique is 12 years old. How old is her brother? Write an equation and solve using the replacement set of (6,7,8) pleaseeeeeee helpppppppppp Do a Hybrid CrossFill out the Punnett Square below for this story:Mary has blue eyes (bb) and David has brown eyes (Bb), if David and Mary have four children what will their eye color be? Will all their children have the same eye color? Why or why not.Child 1: Child 2:Child 3: Child 4: Thirteen more than three times a number is 25. What can you infer about the schools educational and social goals, based on Doves experiences? help would be appreciated ** if you could explain thatd be cool but if not thats ok Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3 Kaden, Keith, and Kipp compete in a series of daily 3-way races. For each race, the probability that Kaden wins is 1/6, the probability that Keith wins is 1/2, and the probability that Kipp wins is 1/3. On a day that Kaden doesn't win, what is the probability that Keith beats Kipp? a file that serves as a starting point for a new document Solve for n.(33)^2 = n^6