In the autumn, many birds will collect seeds and then hide them in various caches throughout their habitat. The birds will guard their caches from other birds, and move the caches if they start to dry out. These caches provide a food source for the birds during the winter. What is an abiotic factor that contributed to the evolution of this set of behaviors? A. being preyed upon by larger birds B. competition with other birds for space C. limited food availability D. cold winter climate

Answers

Answer 1

Answer:cold winter climate

Explanation:During winter specially in the eastern and western part of the world....snows bury grounds and food that enables this organisms live....and cold can also affect them

Answer 2

Answer:

Answer: c. limited food availability

Explanation:

Both biotic and abiotic factors are responsible for shaping the evolutionary framework of the population. Resource availability can be one of the important abiotic  factor in determining the evolutionary dynamics of the population or species. Limitations in resource can result in increase in competition.  According to population exclusion principle when two species compete for the same limiting  resource this results in co-evolution of both the species. But the extent of evolution may vary among the species. The one which undergoes more favorable evolution will be stronger competitor and drive more resources and will be fit for survival in adverse limiting conditions.


Related Questions

Differentiate between endangered species and extinct species (1 point 2 examples)

Answers

Answer:

Endangered: Still around but at risk of going extinct (example: tiger)Extinct: Gone forever (example: wooly mammoth)

Explanation:

An endangered species is one with a reduced population. These species can easily become extinct if all the remaining members die.

I'm always happy to help :)

what is the answer to 9k=27

Answers

Answer:

K=3

Explanation:

We divide both sides by 9 which is 9k/9=27/9 then cancel 9 by 9 and by 9 once by 9 thrice.

algae's general habitat?

Answers

Answer:

Algae is the process to describe that diverse group of photosynthetic lifeforms.

Explanation:

Algae is that environments process to the rivers and lakes to ponds waters an snow, algae living in the contain snow pigments that addition to the surrounding contain distinctive.

Algae is environment near inside water bodies, algae in many components in plants as stems and shoots or leaves nutrients water their body.

Algae like plants an special structure and algae is well defined body in the structure stems and leaves are photosynthetic organisms, algae are free living and symbolic relationship other organisms, there are many types of algae:- Green algae, blue and green algae ,red algae.

Green algae:- green algae to that conduct photosynthesis symbolic relation with higher organisms.

Blue and green algae:- this algae are include dams, river, lakes.

Red algae:- red algae is used in species found in freshwater ecosystem.

Algae is in unicellular and multicellular in environment nature.

Only ------ percent of the food eaten is turned into its own body. ​

Answers

Answer:

10%

Explanation:

there is a the rule that only 10% of the energy is transferred from one trophic level to the other.

this means that only 10% of the food an organism eats  is passed onto the next organism. eg only 10% of the energy in a plant is transferred to a rabbit that eats the plant. After that if  a wolf eats the rabbit only 10% of the energy of food will pass on to the wolf.

Examine the statement. A scientific theory can become a scientific law, but a scientific law cannot become a scientific theory. If the statement is true, select “True.” If it is false, select the option that is true 1.) True 2.) A scientific theory can become a scientific law, and a scientific law can become a scientific theory. 3.) A scientific law can become a scientific theory, but a scientific theory cannot become a scientific law. 4.) A scientific theory cannot become a scientific law, and a scientific law cannot become a scientific theory.

Answers

Answer:

It's true.

Explanation:

In general, a scientific law is the description of an observed phenomenon. It doesn't explain why the phenomenon exists or what causes it. The explanation of a phenomenon is called a scientific theory. It is a misconception that theories turn into laws with enough research.

When the scientists test the idea, they develop a theory by following a set of logical steps. A theory becomes a scientific law once it has been rigorously examined and accepted. Thus, option A is correct.

What A scientific theory can become a scientific law?

One prevalent fallacy is the idea that hypotheses eventually become laws. Despite the number of supporting examples, hypotheses do not actually become laws after repeated testing.

Scientific laws, like theories, explain occurrences that the scientific community has determined to be verifiably true. In general, laws explain what will occur in a specific circumstance and are proven by a mathematical equation, whereas theories explain how the phenomenon occurs.

Therefore, A testable explanation of a natural event is what constitutes a scientific hypothesis. The concept of gravity, for instance, explains why an apple always falls to the ground when.

Learn more about scientific theory here:

https://brainly.com/question/2375277

#SPJ2

What will happen if external factors affect cell division in a group of cells placed in a culture dish? A) Anchorage dependence will cause the cells to attach to each other after dividing. B) Anchorage dependence will prevent the cells from dividing until they attach to the dish. C) Density-dependent inhibition will cause the cells to divide until the dish is completely full. D) Density-dependent inhibition will destroy large cells to create room for new cells.

Answers

Answer:

C) density-dependent inhibition will cause the cells to divide until the dish is completely full

Explanation:

Just took the exam

Illustrate the significance of membranes with the example of viruses

Answers

Answer:

Cell membrane encloses all the cell organelles.  In prokaryotes, membrane is absent and so membrane-bound cell organelles are also absent.

Significance of membrane can be explained with the help of viruses, as viruses lack cell membranes and that is why they require a host for living and uses the host's cell machinery to multiply.

Hence, cell membranes are important for living organisms to live and perform essential biological processes.

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

What is conjunctivitis

Answers

Answer:

[tex] \underline{ \underline \orange{see \: below}}[/tex]

Explanation:

Conjunctivitis is an inflammation, infection of the conjunctiva. It is the most common ocular disease worldwide.It is characterized by a pink appearance because of subconjuctival blood vessels hemorrhage.

Simply, we can define it as :

Conjunctivitis ( pink eye ) is an inflammation or infection of the transparent membrane ( conjunctiva ) that lines your eyelid and covers the white part of your eyeball.

Pink eye is commonly caused by a bacterial or viral infection , an allergic reaction or in babies.

The most common pink eye symptoms include:

Redness in one or both eyesItchiness in one or both eyesA gritty feeling in one or both eyes

Hope I helped !

Best regards!

Cómo explicarías tu que el soporte vegetal es más importante que los animales en un ecosistema?

Answers

Answer:

Las plantas son productores primarios, mientras que los animales son consumidores

Explanation:

La cadena alimenticia está conformada por niveles tróficos donde la energía fluye desde los niveles basales representados por la base de la pirámide, hasta los niveles superiores (pico de la pirámide). De este modo, los organismos representan diferentes eslabones de acuerdo a su posición en la cadena alimenticia. En el primer nivel se encuentran los productores primarios como lo son, por ejemplo, las plantas y algas de ambientes terrestres y acuáticos, respectivamente, siguiendo por los consumidores primarios (por ejemplo, especies hervívoras), continuando sucesivamente por los consumidores secundarios, terciarios y cuaternarios (especies carnívoras), los cuales se encuentran en posiciones cada vez más altas de la pirámide. No obstante, es importante indicar que existen ocasiones donde los consumidores superiores (ya sea secundarios, terciarios y cuaternarios) se alimentan de especies situadas por debajo de diferentes niveles no consecutivos e incluso también de especies pertenecientes al mismo nivel trófico, con lo cual encajando en más de una categoría y dificultando su clasificación en la cadena.

how do i explain this?

Answers

Answer:

Oxygen debt is a physiological phenomenon in which a person consume oxygen at fater rate that it replaced by new oxygen molecules.

As shown in the graph, oxygen debt occurs just after the end of exercise because oxygen is consumed at faster rate during exercise that leads to  increased respiration and body attempts to replace the used oxygen.

To overcome the problem of oxygen debt, a person should take rest that allows the body to replenish its oxygen supply.

Please help!

A. I only

B. II only

C. III only

D. I and III only

Answers

Answer:

a

Explanation:

my reason is that the capacity carrying is 35

Answer:

[tex]\boxed{\mathrm{A. \: I \ only}}[/tex]

Explanation:

The graph does not mention any seasons. The graph is not growing geometrically. For about 9 months the population has been about 35.

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

If Earth’s average surface temperature continues to change over the next 30 years at the same rate it changed between 1980 and 2010, the average temperature will most likely be around

Answers

Answer:

Its B....

Explanation:

Get that 100.

One reason cancer cells are easier to culture than normal cells extracted from an organism is that ________. Group of answer choices cancer cells grow in a more regulated fashion. cancer cells do not need to adhere to a substratum to grow. nutrient requirements for cancer cells are precisely defined. cancer cells are better models for demonstrating what happens in an intact organism.

Answers

Let's list the given options alphabetically to choose the appropriate answer.

One reason cancer cells are easier to culture than normal cells extracted from an organism is that ________. Group of answer choices

A. cancer cells grow in a more regulated fashion.

B. cancer cells do not need to adhere to a substratum to grow.

C. nutrient requirements for cancer cells are precisely defined.

D. cancer cells are better models for demonstrating what happens in an intact organism

Answer:

B.

Explanation:

Cancer cells are easier to culture in comparison to normal cells because cancer cells do not need to adhere to a substratum to grow.

As cancer cells are uncontrolled growth of cells and they do not require any substratum to grow and can easily grow to a culture while a normal cell require optimal conditions to grow in a culture.

Hence, the correct option is "B".

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

How many significant figures in 20.8cm?​

Answers

Answer:

[tex]\Huge \boxed{3}[/tex]

Explanation:

Significant figures include non-zero digits and in between zeros.

2    0   .   8

20.8 has 3 significant figures.

Answer:

[tex]\huge\boxed{3 \ significant \ figures}[/tex]

Explanation:

There are 3 significant figures in

 2   0   .   8

According to the rules of significant figures:

=> All non-zero digits are significant.

=> Zeroes that come between 2 non-zero digits are also significant.

So, 3 significant figures in the term 20.8 cm.

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

The removal of waste products from the body is called

Answers

Answer:

It is called EXCRETION.

Explanation:

This is a process by which metabolic waste is removed from a living organism.

The excretory organs removes these waste.

Accumulation of these in the body is very harmful to our system.

Hope all these helps.

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

Which space exploration activity has most helped astronomers determine the age of the solar system?

collection of lunar rock samples

experiments performed on the International Space Station

placement of mirrors on the lunar surface

collection of deep space images by the Hubble telescope

Answers

The best answer about the space exploration activity that has helped astronomers determine the age of the solar system is :  Collection of Lunar rock samples ( option 1 )

There are several exploration activities in which astronomers partake when they visit the solar system and they include :

experiments on the space station, placement of mirrors on the lunar surface and the collection of space images

But to determine the age of the solar system, collection of rock samples is the best activity, because rocks (one of the first substances found in the solar system )  are as old as where they are found.

Hence the space exploration activity that has helped astronomers determine the age of the solar system is the collection of lunar rock samples

learn more : https://brainly.com/question/21668746

Answer:A

Explanation:Collection of lunar rock samples will help understand the moon more than the other options.

Which label in the graphic represents the energy that is released from glucose by cellular respiration?
Oxygen
Glucose
Energy stored as ATP
Carbon dioxide and water

Answers

Answer:

C) Energy stored as ATP

Explanation:

100% on edge

2. What happens in
terms of energy
when you hold a
craft stick and bend
it slightly?

Answers

Answer:

In a similar way a wooden tongue-depressor stick (like the kind used at the doctor's office) stores elastic potential energy when you bend it (though not if you break it). ... The elastic potential energy that was stored in the stick is transformed into movement, called kinetic energy.

Explanation:

Why might an ecosystem be better able to
cope with a season of forest tent caterpillar
outbreak than an increase in acidic
precipitation?

Answers

Answer: It contains leach aluminium.

Explanation:The ecological effect of acid rain are most Clearly seen in aquatic environment such as, stream, lakes and marshe where it can be harmful to fish and other wildlifes.

What has a greater influence on protein levels? A. Protein degradation has a greater influence because they are denatured faster than the cell can produce them B. mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced C. mRNA destroyer concentration has a greater influence because mRNA is destroyed right after the proteins are produced D. Protein degradation has a greater influence because outside factors like antibiotics can cause it, and it is difficult to recover from

Answers

Answer: b

Explanation: i got the answer wrong and i’m looking at the results rn

Protein is being produced with the help of a process called translation in which mRNA gets translated to produce proteins. The translation is followed after the process of transcription of DNA to RNA.

The cause of the greater influence of protein levels has defined as follows:

The destruction of mRNA could greatly influence protein levels as mRNA is considered the source for proteins to get synthesized. This is because if mRNA gets destroyed, proteins would not have been produced at all. Thus, directly influences the levels of protein.

Thus, we can conclude that mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced. Hence, option (b) is the correct answer.

Learn more about protein here:

https://brainly.com/question/22241855

Which type of chromosomal disorders seems to have the greatest affect on a person’s health—disorders involving autosomes or sex chromosomes? Why do you think this might be the case? thanks in advance

Answers

Answer:

Disorders involving sex chromosomes.

we can take Turner's syndrome n klinefelter's syndrome as examples.

On May 18, 1980, Mount St. Helens in Washington State experienced a huge volcanic eruption after a magnitude 5.1 earthquake. During the eruption, hot ash and pumice poured down the west, south, and east sides of the mountain, melting the snow and ice at the top of the volcano and producing volcanic mudflows. Which type of process first occurred in the ecosystem around Mount St. Helens after it erupted?
primary succession
secondary succession
a climax community
species extinction

Answers

Answer:

Primary succession

Explanation:

Primary succession is mostly cause by volcanic eruption

The first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

What is a primary succession?

The term primary succession refers to the organisms that first occur in an ecosystem after a major event such as the volcanic eruption has taken place.

In this case, the first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

Learn more about primary succession: https://brainly.com/question/26675203

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Other Questions
What is 32 divided by the opposite of 4 the rough frightening waves washed over our tiny sailboat WILL MARK BRAINLIEST! please help me asap! What were the social, political, and economic changes experienced by Americans on the home front during world war II.please be specific and answer for all 3 social, political and economic! thank you! The circumference of a sphere was measured to be 82 cm with a possible error of 0.5 cm. A. Use differentials to estimate the maximum error in the calculated volume.What is the relative error? B. Use differentials to estimate the maximum error in the calculated volume.What is the relative error? READ THE CHAPTERS 1, 2, 3, 4,5 FROM THE BOOK 1 JOHN IN YOUR BIBLE AND ANSWER THE FOLLOWING QUESTIONS: Why did John write this epistle? (1:4, 2:1, 2:26) In this epistle, what did John say that God is and begins with the letters "L" and "L"? (1: 5, 4: 8) What kind of person does Juan call a liar or one who lies? (1:10, 2: 4, 22) What did Juan say his hands had felt? (1: 1) What did John say that cleanses us from all sin? (1: 7) If a Christian sins, what should he do? (1: 9) Everything in the world, what does Juan say it is? (2:16) How did Juan call his readers? (2:12, 13) How does John define sin? (3: 4) What does John say about those who are born again? (3: 9) What Old Testament character does John use as an example of those who do not love one another? (3:12) What does Juan call the person who hates his brother? (3:15) How does John say that we should love? (3:18) Why should we not believe every spirit, but rather test the spirits if they are from God? (4: 1) Who or what is greater than the one in the world? (4: 4) What does John say about the commandments of God? (5: 4) Who are the three who bear witness on earth? (5:8) What are the two word phrases that John used at least five times in the last chapter of I John? (5: 2,15,18-20) What does John say we should guard against at the end of this epistle? (5:21) the standard unit of measurement of preasure2. What isN/m square or Pascal What will come in the circle I will even rate who ever answerAnd give brainliest how many are 4 raised to 2 ??? Line MN passes through points M(4, 3) and N(7, 12). If the equation of the line is written in slope-intercept form, y = mx + b, what is the value of b? 15 9 3 9 Clalm: Animal testing is cruel and immoral.Which statement would be an important counterclaim to address in anargumentative research essay that makes this claim?A. Animals have no feelings and really don't feel any discomfortduring testing.B. Animals are pets and should be considered less than human.O C. Animal testing gets rid of non-domesticated animals.O D. Testing on animals has produced several lifesaving vaccines. how scientific inferences can be made from scientific observations The chapter divides Nevada political history into four eras. What are the two primary factors that have shaped Nevada since 1980? How have these factors shaped both Nevada politics and state and local policy? The accounts receivable turnover is computed as __________ divided by __________. sales; accounts receivable sales; average accounts receivable sales; net income accounts receivable; net income If you already exercise regularly, the health benefits of a new routine will be harder to detect than if you are starting an exercise program for the first time.True or False Which of the following sentences uses the word se in the passive voice?O A. El camarero se lo trajo a ella.B. Mi padre se viste antes de desayunar.O C. Ella se lo pondra.O D. Se dice que hay ms mujeres que hombres en el mundo. What is the result of subtracting the second equation from the first? What is the formula to find the area of the sector? Kela Corporation reports net income of $450,000 that includes depreciation expense of $70,000. Also, cash of $50,000 was borrowed on a 5-year note payable. Based on this data, total cash inflows from operating activities are: What two numbers multiply to negative 12 and add up to negative 13 Chapman Company, a major retailer of bicycles and accessories, operates several stores and is a publicly traded company. The comparative balance sheet and income statement for Chapman as of May 31, 2014, are as follows. The company is preparing its statement of cash flows.CHAPMAN COMPANYCOMPARATIVE BALANCE SHEETAS OF MAY 312014 2013Current assets Cash $28,560 $20,820Accounts receivable 75,850 58,940Inventory 220,080 250,770Prepaid expenses 9,148 7,580Total current assets 333,638 338,110Plant assets Plant assets 600,070 502,460Less: Accumulated depreciationplant assets 150,060 125,320Net plant assets 450,010 377,140Total assets $783,648 $715,250Current liabilities Accounts payable $123,190 $115,200Salaries and wages payable 47,660 72,420Interest payable 27,980 25,490Total current liabilities 198,830 213,110Long-term debt Bonds payable 70,770 100,640Total liabilities 269,600 313,750Stockholders equity Common stock, $10 par 370,460 280,890Retained earnings 143,588 120,610Total stockholders equity 514,048 401,500Total liabilities and stockholders equity $783,648 $715,250CHAPMAN COMPANYINCOME STATEMENTFOR THE YEAR ENDED MAY 31, 2014Sales revenue $1,255,260Cost of goods sold 722,590Gross profit 532,670Expenses Salaries and wages expense 252,580Interest expense 75,830Depreciation expense 24,740Other expenses 8,980Total expenses 362,130Operating income 170,540Income tax expense 43,250Net income $127,290The following is additional information concerning Chapmans transactions during the year ended May 31, 2014.1. All sales during the year were made on account.2. All merchandise was purchased on account, comprising the total accounts payable account.3. Plant assets costing $97,610 were purchased by paying $17,610 in cash and issuing 8,000 shares of stock.4. The "other expenses" are related to prepaid items.5. All income taxes incurred during the year were paid during the year.6. In order to supplement its cash, Chapman issued 957 shares of common stock at par value.7. Cash dividends of $104,312 were declared and paid at the end of the fiscal year.Prepare a statement of cash flows for Chapman Company for the year ended May 31, 2014, using the direct method. (A reconciliation of net income to net cash provided is not required.) (Show amounts that decrease cash flow with either a - sign e.g. -15,000 or in parenthesis e.g. (15,000).)