In the evening, the temperature is 28 degrees. By midnight it has dropped 31 degrees lower. Between midnight and 4 am it goes down 6 more degrees. Then, by 9 am, the temperature goes up 30 degrees. What is the temperature at 9 am?

Answers

Answer 1

Answer: 21 degrees

Step-by-step explanation:

In the evening, the temperature is 28 degrees and by midnight it has dropped 31 degrees lower, the temperature by midnight will be:

= 28° - 31°

= -3°

Between midnight and 4 am it goes down 6 more degrees. The temperature by 4am will be:

= -3° - 6°

= -9°

Then, by 9 am, the temperature goes up 30 degrees, the temperature at 9 am will then be:

= -9° + 30°

= 21°


Related Questions

0/1 For positive integer n, n? = n! · (n − 1)! · … · 1! And n# = n? · (n − 1)? · … · 1?. What is the value of 4# · 3# · 2# · 1#?

Answers

Answer:

331776

Step-by-step explanation:

Since n? = n! · (n − 1)! · … · 1! And n# = n? · (n − 1)? · … · 1?

Then 4# = 4? · (4 − 1)? · (4 − 2)?· 1?

= 4? · 3? · 2?· 1?

Now, n? = n! · (n − 1)! · … · 1!

So, 4? = 4! · (4 − 1)! · (4 − 2)! · 1! = 4! · 3! · 2! · 1! = 288

Thus, 3? = 3! · (3 − 1)! · 1! = 3! · 2! · 1! = 12

Also, 2? = 2! · (2 − 1)! · 1! = 2! · 1! · 1! = 2

and 1? = 1! · (1 − 1)! · 1! = 1! · 0! · 1! = 1

So, 4# = 4? · 3? · 2?· 1? = 288 × 12 × 2 × 1 = 6912

We now find 3#

3# = 3? · (3 − 1)? · 1? = 3? · 2?· 1?

Now, n? = n! · (n − 1)! · … · 1!

So, 3? = 3! · (3 − 1)! · 1! = 3! · 2! · 1! = 12

Thus, 2? = 2! · (2 − 1)! · 1! = 2! · 1! · 1! = 2

and, 1? = 1! · (1 − 1)! · 1! = 1! · 0! · 1! = 1

So, 3# = 3? · 2?· 1? = 12 × 2 × 1 = 24

We now find 2#

2# = 2? · (2 − 1)? · 1? = 2? · 1?· 1?

Now, n? = n! · (n − 1)! · … · 1!

So, 2? = 2! · (2 − 1)! · 1! = 2! · 1! · 1! = 2

1? = 1! · (1 − 1)! · 1! = 1! · 0! · 1! = 1

So, 2# = 2?· 1? = 2 × 1 = 2

We now find 1#

1# = 1? · 1? = 1? · 1?

Now, n? = n! · (n − 1)! · … · 1!

So, 1? = 1! · (1 − 1)! · 1! = 1! · 0! · 1! = 1

And, 1# = 1? · 1? = 1 × 1 = 1

So,  4# · 3# · 2# · 1#? =  6912 · 24 · 2 · 1? = 331776

14 - 2(11 - 5) + [tex]7^{2}[/tex]=

Answers

Answer:

51

Step-by-step explanation:

⚠️THIS IS DUE TODAY⚠️ USE DISTRIBUTIVE PROPERTY

Answers

Answer:

4x + 8

-45 - 5x

7x - 21

Step-by-step explanation:

For the first one

4(x + 2)

for distributive property you multiply the number or symbol next to the outside of the parenthesis, by everything inside the parenthesis.

4(x+2)

4*x = 4x

4*2 = 8

So, this is 4x + 8

-5(9+x)

-5*9= -45

-5*x=-5x

So, this is -45 - 5x

7(x-3)

7*x= 7x

7*-3= -21

This will be 7x - 21

Hope this helps!!

-Ketifa

30% of what number is 7.5?

Answers

Answer should be 2.25

Use substitution to solve the following system of equations.
x + 2y = 13
3x - 5y = 6

Answers

Answer:

{1} x + 2y = 13

{2} 3x - 5y = 6

x = 13 - 2y

substituting into {2}

3x -5y = 6

3( 13 - 2y) - 5y = 6

39 - 6y -5y = 6

-11y = 6 -39

y = -33 /-11

 ( minus and minus cuts in fraction, so the answer will come in positive)

y = 3

now , substituting into {1}

x + 2(3) = 13

x = 13 -6

x = 7

so,

the solution are:-

x = 7

y = 3

I hope this helps a little bit.

Amy owns 3 1/3 acres of farmland. She grows beets on 1/6 of the land. On how many acres
of land does Amy grow beets?
Plz

Answers

Answer:

5/9 acres

Step-by-step explanation:

3 1/3 areas is 10/3

1/6 of the land is covered with beets

[tex]\frac{10}{3} * \frac{1}{6} =\frac{10}{18}[/tex]

[tex]\frac{10}{18}[/tex] will simplify to [tex]\frac{5}{9}[/tex]

Hence the answer is 5/9 acres

Which equation represents a circle that contains the point (-5, 3) and has a center at (-2, 1)? Distance formula: vaa -02 (x - 1)2 + ( + 2)2 = 25 (x + 2)2 + (-1)=5 O (* + 2) + (-1) - 25 (x-1) + ( + 2) = 5

Answers

Given:

The center of the circle = (-2,1).

Circle passes through the point (-5,3).

To find:

The equation of the circle.

Solution:

Radius is the distance between the center of the circle and any point on the circle. So, radius of the circle is the distance between the points (-2,1) and (-5,3).

[tex]Distance=\sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex]

[tex]r=\sqrt{(-5-(-2))^2+(3-1)^2}[/tex]

[tex]r=\sqrt{(-5+2)^2+(2)^2}[/tex]

[tex]r=\sqrt{(-3)^2+(2)^2}[/tex]

On further simplification, we get

[tex]r=\sqrt{9+4}[/tex]

[tex]r=\sqrt{13}[/tex]

The standard form of a circle is:

[tex](x-h)^2+(y-k)^2=r^2[/tex]

Where, (h,k) is the center of the circle and r is the radius of the circle.

Substitute h=-2, k=1 and [tex]r=\sqrt{13}[/tex].

[tex](x-(-2))^2+(y-1)^2=(\sqrt{13})^2[/tex]

[tex](x+2)^2+(y-1)^2=13[/tex]

Therefore, the equation of the circle is [tex](x+2)^2+(y-1)^2=13[/tex].

What is the value of y?
E
(3y + 4) (5y-10)
A.)7
B.)5.5
C.)1.75
D.)6

Answers

Answer:

7

Step-by-step explanation:

3*7+4=25

5*7-10=25

Evaluate the expression using properties of operations.

1
-1.2 = 3x5x (2)
6
OA) -72
OB) 2
OC) 72
OD 120

Answers

Answer:

Step-by-step explanation:

OA) -72

Solve these simultaneous equations:
6x + 8y = 36 6x + 5y = 27

Answers

Answer:

Y = 3

X = 2

Step-by-step explanation:

(6x2) = 12

(8x3) = 24

12 + 24 = 36

(6x2) = 12

(5x3) = 15

12 + 15 = 27

A fun park charges $10 for admission and then two dollars for every ride. Write a function that determines the amount of money spent, Y, based on the number of rides ridden, X.!! please help ahhh

Answers

Answer:

x is I think 5

Step-by-step explanation:

dndjdudjndndjdjdjjd

Two of the sides of a triangle are 7 inches
and 8 inches. If the third side is a whole
number of inches, what is its greatest
possible measure?

Answers

Answer:

11 inches

Step-by-step explanation:

7^2+8^2=c^2

49+64=c^2

113=c^2

square root both side

c=10.63014581

round up and get c=11

hope this helped :)

The opposite sides of a parallelogram are _____?

Answers

Answer:

parallel

Step-by-step explanation:

Answer:

A parallelogram is a quadrilateral

Her why:

whose opposite sides are parallel. The opposite angles of a parallelogram are equal. The opposite sides of a parallelogram are equal.

how do i give brainliest if you tell me i will give you brainliest!!! also please give me the answer to the question!

Answers

For your question the answer would be DK

Answer:

DK

Also to give brainliest, two people will have to answer ur question

There will be an option i think because i never asked a question, so i dont know

You click the brain or crown on the top right of the answer.

Step-by-step explanation:

A television channel broadcasts a baseball game every day. Yesterday's broadcast showed the game for 2 5/6 hours and commercials for 2/3 hour. At this rate, how many hours does the television channel show a game for every hour it shows commercials during its broadcasts?

Answers

Answer:

4.25 hours

Step-by-step explanation:

Given that :

Game broadcast time = 2 5/6 hours = 17/6 hours

Commercials time = 2/3 hours

2/3 hours of commercials = 17/6 of game broadcast

1 hour of commercials = x hours of game broadcast

Cross multiply ;

(2/3)x = 17/6

2x * 6 = 17 * 3

12x = 51

x = 51 / 12

x = 4.25

For every hour it shows commercials, game is broadcasted for 4.25 hours

Hollis goes outside at 2:00. He spends 48 minutes riding his bike and playing with his dog. What time is it now? Write the time in two ways.

Answers

Answer:

2:48

Step-by-step explanation:

48 minutes passed and he went outside at 2:00 im not sure what they mean by write it in 2 ways though

Isaac received 125 for his birthday. He spent 65 on a new video game. How much money, x, how much does issac have

Answers

Answer: $60

Step-by-step explanation:

A bag contains 3 white balls, 4 green balls, and 5 red balls. A ball is drawn at random. How many total number of outcomes are there?​

Answers

Answer:

12

Step-by-step explanation:

5+4+3 = 12

Answer:

12 is the total outcome.......

Step-by-step explanation:

3+4+5=12 is the ans.....

hope this will help u.....

plzzzzzzzzzzzzzzzzzzzzzzzzz help

Answers

Answer:1. C2. x = 83. A4. A (I and III)

Hope this helps!! ♥︎

What is the equation of the line that passes through the points (15,9) and (-2, 9)?
Oy - 9
11
Oy ----x+ 9
Oy=-17
Oy - 6x + 11

Answers

Answer:

c

Step-by-step explanation:

A package of sliced cheese weighs 2 1/4 pounds and costs $18. If 3 slices weigh a total of 2 ounces, how much do the 3 slices cost?

Answers

10 slices will cost 10 dollars

I really need help with the radius,diameter and area off circles and halfcircles

Answers

Answer:

Radius refers to the distance between the center of the circle to any point of the circle

Diameter refers to the distance between any two points on the circle passing through the center of circle, it is also equal to radiusx2

Area of circle = πr², where π is a constant (≈3.14159), r is the radius

Halfcircles is basically half of the circle. It has the same radius and diameter as it's full circle but the area of the halfcircle is equal to half of the area of the full circle.

Step-by-step explanation:

Tell whether each pair of angle measurements are complementary, supplementary or neither.  36°,24°  18°,72°  96°,84°

Answers

Given:

The pairs of angles are:

36°,24°

18°,72°

96°,84°

To find:

Whether each pair of angle measurements are complementary, supplementary or neither.

Solution:

Two angles are complementary if there sum is 90 degrees.

Two angles are supplementary if there sum is 180 degrees.

For 36° and 24°,

[tex]36^\circ+24^\circ =60^\circ[/tex]

So, this pair is neither complementary not supplementary.

For 18° and 72°,

[tex]18^\circ+72^\circ =90^\circ[/tex]

So, this pair is complementary.

For 96° and 84°,

[tex]96^\circ+84^\circ =180^\circ[/tex]

So, this pair is supplementary.

Solve for x.parallelogram
Plz show steps so I can learn

Answers

Answer:

in a parallelogram .......the sum.of adjacent angles is 180

11x-10+80=180

11x=110

x=10

Felipe calculated that he uses about 545 gallons of fuel each year. His car's owner's manual says that it is approved to use regular fuel. How much money can he save each year by switching from premium fuel, at $4.59 per gallon, to regular fuel at $4.18 per gallon?

$0.41

$2,501.55

$223.45

$2,278.10

$4,779.65

Answers

Answer:

$223.45

Step-by-step explanation:

premium fuel: 4.59 x 545

= 2501.55

regular fuel: 4.18 x 545

=2278.1

2501.55-2278.1 = 223.45

Find the area. The figure is not drawn to scale.

Answers

Answer:

A = 1/2 (13) ( 9 +9)

A = 1/2 (13) (18)

A = 117

Would the answer be 550.25?

Answers

Answer:

44

Step-by-step explanation:

she set aside $44 for vacation

pls brainliest btw

what is 4/7 + 1/8 in math

Answers

correct answer is 39/56

Ed wants to bicycle at least 75 miles this week. The inequality 11 + 4b > 75 can be used to find the average number of miles he should bike on his remaining 4 bike rides this week.

Sorry for the inconvenience, but I need this done and I need help. This is the last question of this quiz. Please Help.​

Answers

Answer: Ed should bike at least more than 16 miles

Step-by-step explanation:

11 + 4b > 75

4b > 64

b > 16

Ed should bike 16 miles

PLEASEEEEEEEE HELPPPPPPP

Answers

It would be the 4th one
Other Questions
A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 (HELP ASAP)Select the graph which best represents this scenario:The amount of pancake batter that you must mix increaseswith the number of people who come to breakfast. It takes3 cups of batter to serve 10 people.(More context in the picture) What is not a type of text format that will automatically be converted by Outlook into a hyperlink?O email addressO web addressO UNC pathO All will be automatically converted. Cup G has a diameter of 4 in. and a height of 8 in. Find the volume of Cup G. Where dose the earliest known Indian literature come from which element is shown in the picture here? Grapes cost $3.25 per pound. Darius paid a total of $26 for grapes.How many pounds of grapes did Darius buy? Which time interval has the greatest speed? resulve las siguientes operaciones matematicas en tu cuadernk PLEASE HELP! Please help me I dont understand how to do this and it has to be done by tonight!!! what effects can war have on politics and society? (20 points)What is the measure of ^1?A:230B:130C:125D:115